Reader TTS

ABSTRACT Polymorphisms in _CASP8_ at 2q33.1 have been associated with the risk of developing cancer, specifically, the D302H variant (rs1045485) with breast cancer in the European population

and the −652 6N ins/del promoter variant (rs3834129) with multiple tumours including colorectal cancer (CRC) in the Chinese population. We evaluated the relationship between −652 6N ins/del

and D302H variants and risk of developing CRC in the UK population by genotyping 4016 cases and 3749 controls. Both variants showed no evidence of an association with risk of developing CRC

(_P_=0.42 and 0.22, respectively). In contrast, the recently identified CRC susceptibility allele rs6983267 mapping to 8q24 was significantly associated with disease risk (_P_=8.94 × 10−8).

It is thus very unlikely that variation in _CASP8_ defined by −652 6N ins/del or D302H influences the risk of CRC in European populations. The implications of our findings both in terms of

population-specific effects and publication bias are discussed. SIMILAR CONTENT BEING VIEWED BY OTHERS RELATIONSHIP BETWEEN 233 COLORECTAL CANCER RISK LOCI AND SURVIVAL IN 1926 PATIENTS WITH

ADVANCED DISEASE Article Open access 22 June 2023 GENETIC RISK FACTORS FOR COLORECTAL CANCER IN MULTIETHNIC INDONESIANS Article Open access 11 May 2021 _CDH1_ GERMLINE VARIANTS ARE ENRICHED

IN PATIENTS WITH COLORECTAL CANCER, GASTRIC CANCER, AND BREAST CANCER Article Open access 23 December 2021 MAIN Although inherited susceptibility is responsible for ∼30% of all colorectal

cancers (CRCs) (Lichtenstein et al, 2000), high-penetrance, germline mutations in APC, the mismatch repair (MMR) genes, MUTYH/MYH, SMAD4, ALK3 and STK11/LKB1 account for <5% of cases

(Aaltonen et al, 2007). Much of the remaining variation in genetic risk is likely to be explained by combinations of more common, lower-penetrance variants. Although such common alleles may

only confer modest differences in CRC risk through interaction with other common alleles, some individuals will be placed at a significant risk. Hence, screening for a battery of such

markers potentially has clinical utility. It is, however, clear that robust validation of novel CRC predisposition loci is required to avoid spurious testing. The availability of

high-resolution linkage disequilibrium (LD) maps, and consequently of sets of tagging SNPs that capture much of the common sequence variation, allows whole-genome-wide association studies

(GWAS) for disease associations to be efficiently conducted. This approach is attractive as it is unbiased and does not depend upon prior knowledge of function or presumptive involvement of

any gene in disease causation. Furthermore, it minimises the possibility of failing to identify important variants in hitherto unstudied genes. Recent GWAS have vindicated the assertion of

the ‘common-disease common-variant’ hypothesis providing evidence for common disease variants for CRC mapping to 8q24 (Haiman et al, 2007; Tomlinson et al, 2007; Zanke et al, 2007) and

_SMAD7_ (Broderick et al, 2007). The applicability of the GWA strategy, however, depends heavily on the robustness of tagging, and for many regions of the genome this may not be optimal.

This is a potentially serious limitation for regions of the genome to which strong candidate genes map and are not properly tagged. Caspase 8 (_CASP8_; MIM 601763) is a key regulator of

apoptosis or programmed cell death, an essential defense mechanism against hyperproliferation and malignancy. Polymorphic variation in _CASP8_ has been reported to influence cancer risk. The

variant D302H (rs1045485) has been associated with risk of breast cancer in the European population (Cox et al, 2007). Furthermore, the −652 6N ins/del promoter variant (rs3834129) has been

associated with the risk of developing multiple tumour types, including CRC in the Chinese population (Sun et al, 2007). It has been asserted that this specific variant has direct

functional effects on cancer risk on the basis that the deletion destroys a stimulatory protein 1 binding site and decreases _CASP8_ transcription (Sun et al, 2007). Moreover, biochemical

analyses have shown that T lymphocytes with the deletion variant have a reduced caspase-8 activity and activation-induced cell death upon stimulation with cancer cell antigens (Sun et al,

2007). To confirm or refute the purported association between −652 6N ins/del and CRC risk and evaluate the relationship between D302H and CRC risk, we genotyped 4016 cases and 3749 controls

ascertained from the UK population. Risk estimates were compared with those associated with the 8q24 risk allele rs6983267 using previously generated data (Tomlinson et al, 2007). MATERIALS

AND METHODS SUBJECTS Cases (1930 males, 2086 females; mean age at diagnosis 59.5 years; s.d.±8.7) were ascertained through the National Study of Colorectal Cancer Genetics (NSCCG) (Penegar

et al, 2007). Healthy control individuals (2092 males, 1657 females; mean age 60 years; s.d.±10.8) were recruited from NSCCG (_n_=1843), the Genetic Lung Cancer Predisposition Study

(1999–2004; _n_=479) and the Royal Marsden Hospital Trust/Institute of Cancer Research Family History and DNA Registry (1999–2004; _n_=1427) (Tomlinson et al, 2007). Cases and controls were

British Caucasians, and there were no obvious differences in the demography of cases and controls in terms of place of residence within the UK. The study was conducted with ethics committee

approval (MREC/98/2/67; MREC02/0/97) in accordance with the tenets of the Declaration of Helsinki, and written informed consent was obtained from all subjects. GENOTYPING DNA was extracted

from samples using conventional methodologies and quantified using PicoGreen (Invitrogen Corp., Carlsbad, CA, USA). Genotyping of D302H (rs1045485) and −652 6N ins/del (rs3834129) was

conducted by competitive allele-specific PCR KASPar chemistry (KBiosciences Ltd, Hertfordshire, UK). For rs1045485, allele-specific primers were:

GAAGGTGACCAAGTTCATGCTAGATTTGCTCTACTGTGCAGTCATC and GAAGGTCGGAGTCAACGGATTAGATTTGCTCTACTGTGCAGTCATG; common primer: GACCACGACCTTTGAAGAGCTTCAT. For rs3834129, allele-specific primers were:

GAAGGTCGGAGTCAACGGATTGCCATAGYAATTCTTGCTCTGCCAA and GAAGGTGACCAAGTTCATGCTGCCATAGYAATTCTTGCTCTGCCAC; common primer: CACTGAGACGTTAAGTAACTTGCCCAA. Genotyping quality control was tested using

duplicate DNA samples within studies and SNP assays, together with direct sequencing of subsets of samples to confirm genotyping accuracy. For both SNPs, 99.6% concordant results were

obtained. STATISTICAL ANALYSES Statistical analyses were undertaken using STATA Software (StataCorp LP, College Station, TX, USA). To test for population stratification, the distribution of

genotypes in controls was tested for a departure from Hardy–Weinberg equilibrium (HWE). Logistic regression was used to calculate odds ratios (ORs) and the associated 95% confidence

intervals (CIs). Power calculations were undertaken on the basis of proportions. In all analyses, _P_-value of 0.05 was considered significant. Linkage disequilibrium between genotypes was

enumerated using the metric _R_2. This was estimated using Haploview software. RESULTS AND DISCUSSION D302H (rs1045485) and −652 6N ins/del (rs3834129) genotypes were obtained for 96% (3843)

and 97% (3879) of CRC cases and 97% (3631) and 98% (3661) of controls, respectively; hence, there was no evidence of any systematic bias in genotyping. Furthermore, there was no evidence of

population stratification, as the genotype distribution in controls for both variants satisfied HWE (Table 1). The frequency of the 302H allele (0.132) in our study was similar to that

reported in a other European populations (0.130 (Cox et al, 2007) and 0.125 CEPH (http://www.ncbi.nlm.nih.gov/projects/SNP/)). In the Chinese population, this SNP has, however, been

documented to be nomomorphic. The frequency of −652 6N del allele in controls was 0.501, again similar to previously published data on Europeans. It is, however, markedly different to that

observed in the Chinese population in which the frequency is ∼25%. The frequencies of both variants were not significantly different in cases and controls (allele test of significance,

_P_=0.423 and 0.216 respectively; Table 1). There was not strong LD between rs3834129 and rs1045485 (_r_2=0.19). By comparison, the 8q24 variant rs6983267 displayed a strong association with

CRC risk (_P_=8.94 × 10−8). Based on the number of cases and controls analyzed and the population frequencies of the rare alleles of each polymorphism, our study has ∼90% power to

demonstrate an OR of 1.2 associated with each variant stipulating a _P_-value of 0.05. Hence, while the D302H polymorphism has been robustly shown to influence breast cancer risk (Frank et

al, 2006), our study indicates that the variant is unlikely to affect risk of CRC and hence its effect on cancer risks is not generic. Nevertheless, we cannot exclude the possibility that

each variant is associated with more modest risks of CRC (i.e. <1.2, based upon the upper 95% CI for ORs). The −652 6N ins/del variant has been reported to influence both breast and CRC

in the Chinese population. A recent study of breast cancer with the Europeans has failed to confirm an association with breast cancer risk (Frank et al, 2007). In our study, genotyping was

conducted by allele-specific PCR, generally acknowledged to provide a robust means of assigning genotypes. In contrast, Sun _et al_, used PCR-RFLP to determine genotypes, which through

incomplete digestion of PCR product can lead to misassignment of alleles. This can lead to systematic basis, especially if cases and controls are not genotyped simultaneously. Although we

cannot entirely exclude the possibility of such random measurement error as the basis of non-replication of study findings, it seems unlikely to be a major issue. While there is evidence

that difference in genetic frequencies across populations of different racial origin is not generally accompanied by differences in population-specific genetic effects (Ioannidis et al,

2004), we cannot exclude this possibility. On the basis of _in vitro_ functional assays, it was asserted that this variant has direct impact of cancer risk via apoptosis. Allele frequencies

are, however, very different between populations and the possibility of differential LD in the different populations remains a basis for non-replication. Alternatively, as the study

purporting that −652 6N ins/del influences CRC was based on a relatively small sample size to that advocated for GWA analyses, there remains the distinct possibility of a type 1 error

coupled with publication bias. If additional studies of these variants are conducted, it opens up the possibility of using meta-analysis to provide the final step in confirming or refuting

an association with cancer risk. CHANGE HISTORY * _ 16 NOVEMBER 2011 This paper was modified 12 months after initial publication to switch to Creative Commons licence terms, as noted at

publication _ REFERENCES * Aaltonen L, Johns L, Jarvinen H, Mecklin JP, Houlston R (2007) Explaining the familial colorectal cancer risk associated with mismatch repair (MMR)-deficient and

MMR-stable tumors. _Clin Cancer Res_ 13: 356–361 Article  CAS  Google Scholar  * Broderick P, Carvajal-Carmona L, Pittman AM, Webb E, Howarth K, Rowan A, Lubbe S, Spain S, Sullivan K,

Fielding S, Jaeger E, Vijayakrishnan J, Kemp Z, Gorman M, Chandler I, Papaemmanuil E, Penegar S, Wood W, Sellick G, Qureshi M, Teixeira A, Domingo E, Barclay E, Martin L, Sieber O, Kerr D,

Gray R, Peto J, Cazier JB, Tomlinson I, Houlston RS (2007) A genome-wide association study shows that common alleles of SMAD7 influence colorectal cancer risk. _Nat Genet_ 39: 1315–1317

Article  CAS  Google Scholar  * Cox A, Dunning AM, Garcia-Closas M, Balasubramanian S, Reed MW, Pooley KA, Scollen S, Baynes C, Ponder BA, Chanock S, Lissowska J, Brinton L, Peplonska B,

Southey MC, Hopper JL, McCredie MR, Giles GG, Fletcher O, Johnson N, dos Santos Silva I, Gibson L, Bojesen SE, Nordestgaard BG, Axelsson CK, Torres D, Hamann U, Justenhoven C, Brauch H,

Chang-Claude J, Kropp S, Risch A, Wang-Gohrke S, Schurmann P, Bogdanova N, Dork T, Fagerholm R, Aaltonen K, Blomqvist C, Nevanlinna H, Seal S, Renwick A, Stratton MR, Rahman N, Sangrajrang

S, Hughes D, Odefrey F, Brennan P, Spurdle AB, Chenevix-Trench G, Beesley J, Mannermaa A, Hartikainen J, Kataja V, Kosma VM, Couch FJ, Olson JE, Goode EL, Broeks A, Schmidt MK, Hogervorst

FB, Van’t Veer LJ, Kang D, Yoo KY, Noh DY, Ahn SH, Wedren S, Hall P, Low YL, Liu J, Milne RL, Ribas G, Gonzalez-Neira A, Benitez J, Sigurdson AJ, Stredrick DL, Alexander BH, Struewing JP,

Pharoah PD, Easton DF (2007) A common coding variant in CASP8 is associated with breast cancer risk. _Nat Genet_ 39: 352–358 Article  CAS  Google Scholar  * Frank B, Hemminki K,

Wappenschmidt B, Meindl A, Klaes R, Schmutzler RK, Bugert P, Untch M, Bartram CR, Burwinkel B (2006) Association of the CASP10 V410I variant with reduced familial breast cancer risk and

interaction with the CASP8 D302H variant. _Carcinogenesis_ 27: 606–609 Article  CAS  Google Scholar  * Frank B, Rigas SH, Bermejo JL, Wiestler M, Wagner K, Hemminki K, Reed MW, Sutter C,

Wappenschmidt B, Balasubramanian SP, Meindl A, Kiechle M, Bugert P, Schmutzler RK, Bartram CR, Justenhoven C, Ko YD, Bruning T, Brauch H, Hamann U, Pharoah PP, Dunning AM, Pooley KA, Easton

DF, Cox A, Burwinkel B (2007) The CASP8 −652 6N del promoter polymorphism and breast cancer risk: a multicenter study. _Breast Cancer Res Treat_; e-pub ahead of

print.doi:10.1007/S10549.007.9752z * Haiman CA, Le Marchand L, Yamamato J, Stram DO, Sheng X, Kolonel LN, Wu AH, Reich D, Henderson BE (2007) A common genetic risk factor for colorectal and

prostate cancer. _Nat Genet_ 39: 954–956 Article  CAS  Google Scholar  * Ioannidis JP, Ntzani EE, Trikalinos TA (2004) ‘Racial’ differences in genetic effects for complex diseases. _Nat

Genet_ 36: 1312–1318 Article  CAS  Google Scholar  * Lichtenstein P, Holm NV, Verkasalo PK, Iliadou A, Kaprio J, Koskenvuo M, Pukkala E, Skytthe A, Hemminki K (2000) Environmental and

heritable factors in the causation of cancer – analyses of cohorts of twins from Sweden, Denmark, and Finland. _N Engl J Med_ 343: 78–85 Article  CAS  Google Scholar  * Penegar S, Wood W,

Lubbe S, Chandler I, Broderick P, Papaemmanuil E, Sellick G, Gray R, Peto J, Houlston R (2007) National study of colorectal cancer genetics. _Br J Cancer_ 97 (9): 1305–1309 Article  CAS 

Google Scholar  * Sun T, Gao Y, Tan W, Ma S, Shi Y, Yao J, Guo Y, Yang M, Zhang X, Zhang Q, Zeng C, Lin D (2007) A six-nucleotide insertion-deletion polymorphism in the CASP8 promoter is

associated with susceptibility to multiple cancers. _Nat Genet_ 39: 605–613 Article  CAS  Google Scholar  * Tomlinson I, Webb E, Carvajal-Carmona L, Broderick P, Kemp Z, Spain S, Penegar S,

Chandler I, Gorman M, Wood W, Barclay E, Lubbe S, Martin L, Sellick G, Jaeger E, Hubner R, Wild R, Rowan A, Fielding S, Howarth K, Silver A, Atkin W, Muir K, Logan R, Kerr D, Johnstone E,

Sieber O, Gray R, Thomas H, Peto J, Cazier JB, Houlston R (2007) A genome-wide association scan of tag SNPs identifies a susceptibility variant for colorectal cancer at 8q24.21. _Nat Genet_

39: 984–988 Article  CAS  Google Scholar  * Zanke BW, Greenwood CM, Rangrej J, Kustra R, Tenesa A, Farrington SM, Prendergast J, Olschwang S, Chiang T, Crowdy E, Ferretti V, Laflamme P,

Sundararajan S, Roumy S, Olivier JF, Robidoux F, Sladek R, Montpetit A, Campbell P, Bezieau S, O’Shea AM, Zogopoulos G, Cotterchio M, Newcomb P, McLaughlin J, Younghusband B, Green R, Green

J, Porteous ME, Campbell H, Blanche H, Sahbatou M, Tubacher E, Bonaiti-Pellie C, Buecher B, Riboli E, Kury S, Chanock SJ, Potter J, Thomas G, Gallinger S, Hudson TJ, Dunlop MG (2007)

Genome-wide association scan identifies a colorectal cancer susceptibility locus on chromosome 8q24. _Nat Genet_ 39: 989–994 Article  CAS  Google Scholar  Download references

ACKNOWLEDGEMENTS We are grateful to all the patients and individuals for their participation. The study was supported by grants from Cancer Research UK. PB was funded by a grant from

Leukaemia research. AUTHOR INFORMATION Author notes * A M Pittman and P Broderick: These authors contributed equally to this work AUTHORS AND AFFILIATIONS * Section of Cancer Genetics,

Institute of Cancer Research, Sutton, UK A M Pittman, P Broderick, K Sullivan, S Fielding, E Webb, S Penegar & R S Houlston * Molecular and Population Genetics Laboratory, London

Research Institute, Cancer Research UK, London, UK I Tomlinson Authors * A M Pittman View author publications You can also search for this author inPubMed Google Scholar * P Broderick View

author publications You can also search for this author inPubMed Google Scholar * K Sullivan View author publications You can also search for this author inPubMed Google Scholar * S Fielding

View author publications You can also search for this author inPubMed Google Scholar * E Webb View author publications You can also search for this author inPubMed Google Scholar * S

Penegar View author publications You can also search for this author inPubMed Google Scholar * I Tomlinson View author publications You can also search for this author inPubMed Google

Scholar * R S Houlston View author publications You can also search for this author inPubMed Google Scholar CORRESPONDING AUTHOR Correspondence to R S Houlston. ADDITIONAL INFORMATION WEB

ADDRESSES Illumina: http://www.illumina.com/ HAPMAP: http://www.hapmap.org/ Haploview: http://www.broad.mit.edu/mpg/haploview/ COMPETING INTEREST The authors declare no competing financial

interest. RIGHTS AND PERMISSIONS From twelve months after its original publication, this work is licensed under the Creative Commons Attribution-NonCommercial-Share Alike 3.0 Unported

License. To view a copy of this license, visit http://creativecommons.org/licenses/by-nc-sa/3.0/ Reprints and permissions ABOUT THIS ARTICLE CITE THIS ARTICLE Pittman, A., Broderick, P.,

Sullivan, K. _et al._ _CASP8_ variants D302H and −652 6N ins/del do not influence the risk of colorectal cancer in the United Kingdom population. _Br J Cancer_ 98, 1434–1436 (2008).

https://doi.org/10.1038/sj.bjc.6604314 Download citation * Received: 13 December 2007 * Revised: 16 February 2008 * Accepted: 27 February 2008 * Published: 25 March 2008 * Issue Date: 22

April 2008 * DOI: https://doi.org/10.1038/sj.bjc.6604314 SHARE THIS ARTICLE Anyone you share the following link with will be able to read this content: Get shareable link Sorry, a shareable

link is not currently available for this article. Copy to clipboard Provided by the Springer Nature SharedIt content-sharing initiative KEYWORDS * _CASP8_ * colorectal cancer * risk *

polymorphism