Reader TTS

ABSTRACT The functional role of microRNA-375 (miR-375) in the development of prostate cancer (PCa) remains controversial. Previously, we found that plasma exosomal miR-375 is significantly

elevated in castration-resistant PCa (CRPC) patients compared with castration-sensitive PCa patients. Here, we aimed to determine how miR-375 modulates CRPC progression and thereafter to

evaluate the therapeutic potential of human umbilical cord mesenchymal stem cell (hucMSC)-derived exosomes loaded with miR-375 antisense oligonucleotides (e-375i). We used miRNA in situ

hybridization technique to evaluate miR-375 expression in PCa tissues, gain- and loss-of-function experiments to determine miR-375 function, and bioinformatic methods, dual-luciferase

reporter assay, qPCR, IHC and western blotting to determine and validate the target as well as the effects of miR-375 at the molecular level. Then, e-375i complexes were assessed for their

antagonizing effects against miR-375. We found that the expression of miR-375 was elevated in PCa tissues and cancer exosomes, correlating with the Gleason score. Forced expression of

miR-375 enhanced the expression of EMT markers and AR but suppressed apoptosis markers, leading to enhanced proliferation, migration, invasion, and enzalutamide resistance and decreased

apoptosis of PCa cells. These effects could be reversed by miR-375 silencing. Mechanistically, miR-375 directly interfered with the expression of phosphatase nonreceptor type 4 (PTPN4),

which in turn stabilized phosphorylated STAT3. Application of e-375i could inhibit miR-375, upregulate PTPN4 and downregulate p-STAT3, eventually repressing the growth of PCa. Collectively,

we identified a novel miR-375 target, PTPN4, that functions upstream of STAT3, and targeting miR-375 may be an alternative therapeutic for PCa, especially for CRPC with high AR levels.

SIMILAR CONTENT BEING VIEWED BY OTHERS SECRETED MIR-210-3P, MIR-183-5P AND MIR-96-5P REDUCE SENSITIVITY TO DOCETAXEL IN PROSTATE CANCER CELLS Article Open access 08 December 2023 EXOSOMAL

LONG NONCODING RNA HOXD-AS1 PROMOTES PROSTATE CANCER METASTASIS VIA MIR-361-5P/FOXM1 AXIS Article Open access 04 December 2021 LOSS OF MIR-936 LEADS TO ACQUISITION OF ANDROGEN-INDEPENDENT

METASTATIC PHENOTYPE IN PROSTATE CANCER Article Open access 12 October 2022 INTRODUCTION Prostate cancer (PCa) accounts for one of the most common and lethal malignancies in men1. Currently,

androgen deprivation therapy (ADT) is the first-line treatment for PCa. Unfortunately, most PCa cases gradually progress to metastatic castration-resistant prostate cancer (mCRPC) despite a

good initial response2. When mCRPC occurs, an androgen receptor (AR) antagonist is usually prescribed3. However, due to aberrant activation of AR-dependent and AR-independent signaling,

acquired resistance to AR antagonists has been proven to be another major challenge in PCa treatment4. Therefore, investigators still need to identify feasible therapeutic targets to hamper

PCa progression. Gene therapy, either using short hairpin RNA or short interfering RNA to silence the expression of oncogenes, is emerging as an attractive treatment for various

malignancies. MicroRNAs (miRNAs), which posttranscriptionally regulate gene expression levels pivotal for tumorigenesis, are feasible targets of gene therapy5. Our previous study

demonstrated that the level of plasma exosomal miR-375 in CRPC patients was higher than that in castration-sensitive prostate cancer patients and predicted poor survival6. It has been

reported that overexpression of miR-375 drives neuroendocrine differentiation states in PCa7. In CRPC, miR-375 can reduce cell sensitivity to docetaxel treatment by targeting SEC23A and

YAP18. This evidence suggests that miR-375 might play an onco-miR role in PCa, and antisense oligonucleotides (ASOs) targeting miR-375 may be a therapeutic option. However, conflicting

findings have also been reported9, indicating that the mechanism of miR-375 in the development of PCa remains to be precisely elucidated and that the feasibility of targeting miR-375 as a

curative option remains to be determined. To enhance the in vivo transportation efficiency as well as the effects of therapeutic oligonucleotides, exosomes prepared from human umbilical cord

mesenchymal stem cells (hucMSCs) are regarded as an ideal drug delivery vehicle10. Engineered exosomes loaded with 5-FU and miR-21i oligonucleotides were capable of inhibiting tumor growth

while increasing apoptosis of 5-FU-resistant colorectal cancer cells11. Exosomes derived from hucMSCs loaded with miRNA-221 ASOs could dramatically inhibit the proliferation of colon

cancer12. Traditionally, these therapeutic oligonucleotides are embedded in exosomes by electroporation or by genetic engineering of exosome-secreting cells. However, these procedures are

time- and labor-consuming with low yield. Therefore, increasing the stability of therapeutic oligonucleotides and directly modifying exosomes seem to be promising solutions. MiRNA ASOs

synthesized with phosphorodiamidate morpholino oligonucleotides (PMOs) instead of traditional pentose phosphate nucleotides are uncharged oligonucleotides, render the oligomer exempt from

nuclease digestion and inhibit miRNA activity by complementary binding to mature miRNA or pri-miRNA13, which is especially suitable for in vivo application in harsh digestive environments.

Lobo et al. verified that PMOs against CD44v6-expressing tumors can increase gastric cancer (GC) sensitization to chemotherapy and delay GC progression14. Ma et al. also reported that

PMO-mediated suppression of P53 sensitizes cancer cells to chemotherapy15. In this study, we initially focused on the role of miR-375 in PCa development and enzalutamide resistance. After

demonstrating that miR-375 contributes to PCa progression through phosphatase nonreceptor type 4 (PTPN4)/STAT3 signaling and could be a novel therapeutic target for PCa, we next loaded

hucMSC-derived exosomes with miR-375 antisense PMOs (e-375i) by an in vitro engineering method and then evaluated the therapeutic and drug resensitizing effects of these miR-375 targeting

complexes in vitro and in vivo. MATERIALS AND METHODS PREPARATION OF CELL LINES, TISSUE SPECIMENS, AND REAGENTS DU145, PC-3, LNCaP and BPH1 cells (the Institute of Biochemistry and Cell

Biology of the Chinese Academy of Sciences, Shanghai, China) were maintained in RPMI 1640 (Biological Industries, Israel), and HEK-293 cells were maintained in DMEM (Biological Industries,

Israel). Both basal media were supplemented with 10% FBS (Biological Industries, Israel) and 1% penicillin–streptomycin (Beyotime Biotechnology, Shanghai, China). All of the cells were

incubated at 37 °C in a humidified environment supplied with 5% CO2. We collected 30 PCa and 17 benign prostate hyperplasia tissues from Harbin Medical University Cancer Hospital.

Enzalutamide (Selleck, Houston, USA) was dissolved in DMSO (Sigma-Aldrich, USA) and stored at −20 °C until use. Sequences of PMOs (Gene Tools, https://www.gene-tools.com/, USA) were as

follows: miR-375 antisense PMO (miR-375i): GCCTCACGCGAGCCGAACGAACAAA and negative control (NC): CCTCTTACCTCAGTTACAATTTATA. The oligomers were dissolved in PBS and stored at 4 °C until use.

MIRNA IN SITU HYBRIDIZATION (ISH) A tissue microarray composed of 150 specimens (3 healthy prostate, 54 paracancerous tissues and 93 prostate cancer tissues) (Shanghai Outdo Biotech, China)

was used to assess miR-375 levels with a miRNAscope Kit RED (#324500, Advanced Cell Diagnostics, USA). Briefly, dewaxed tissue slide was hybridized with the customized miR-375-specific probe

(Advanced Cell Diagnostics, USA) at 40 °C for 2 h. Then, the slide was subjected to signal amplification using an HD Reagent detection kit, and the hybridization signal was visualized with

a DAB kit. A MiRNAscope positive control probe (#727871-S1, Advanced Cell Diagnostics, USA) and negative control probe (#727881-S1, Advanced Cell Diagnostics, USA) were used to ensure the

interpretability of the hybridization. The signals were scored based on the following semi-quant guidelines: 0 (≤1 dot per cell), 1 (2–10 dots per cell and very few dot clusters), 2 (11–20 

dots per cell and <25% dots were enclosed by clusters), and 3 (>20 dots per cell and >25% dots were enclosed by clusters). BIOINFORMATIC ANALYSIS EvmiRNA was used to assess miR-375

expression in different cancer-derived exosomes and microvesicles. The transcriptive data of miR-375 between disparate cancer tissues and normal control tissues were from The Cancer Genome

Atlas (TCGA) and processed with R software (version 3.6.3). We also interrogated databases to calculate the unique expression levels of miR-375 (Starbase

http://starbase.sysu.edu.cn/index.php) and PTPN4 (UALCAN http://ualcan.path.uab.edu/) in tumor and normal tissues) and the correlation between miR-375 and PTPN4. MiRWalk

(http://mirwalk.umm.uni-heidelberg.de/), TargetScan (http://www.targetscan.org/vert_72/), StarBase, miRsystem (http://mirsystem.cgm.ntu.edu.tw/) and RNA22V2

(https://cm.jefferson.edu/rna22/Interactive/)were used to predict target genes of miR-375. The relationship between miR-375 and patients’ cancer stages of PCa was explored using

Kruskal-Wallis R Test in the TCGA database (Normal: 52 cases, 6&7&8: 359 cases, 9&10:140 cases). The predictive power of miR-375 in PCa was expressed as the area under the

receiver operator characteristic (ROC) curve using the pROC package. Gene set enrichment analysis (GSEA) was adopted to statistically explore differentially expressed genes relevant to the

expression of PTPN4 in the TCGA database. First, the raw counts of differentially expressed PTPN4-related genes were downloaded from the TCGA-PRAD data portal by the Deseq2 package version

1.26.0. Then, genes with an adjusted _P_ value <0.05 and log2-fold change >1.5 were considered statistically significant and were used for GSEA. The returned results were visualized

via clusterProfiler package version 3.14.3 and ggplot2 package version 3.3.3. The enrichment pathways were evaluated by the _P_ value and normalized enrichment score. GEPIA

(http://gepia.cancer-pku.cn/) was performed to obtain the top 100 genes that had similar expression patterns as PTPN4 in prostate cancer. These similar genes were subjected to GO and KEGG

analysis using R packages (clusterProfiler package 3.14.3 for enrichment analysis and org.Hs.eg.db package for ID Conversion). REAL-TIME PCR Total RNA from tissues or cultured cells was

isolated using TRIzol reagent (Invitrogen Life Technologies, Carlsbad, USA). The miRNA and mRNA were reverse transcribed with a ReverTra Ace qPCR RT Kit (TOYOBO, Japan) in a reaction mixture

containing a miR-specific stem-loop reverse transcription primer (miR-375 RT: GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACTCACG) for miRNA or a universal poly (T) primer for mRNA.

qRT-PCR was carried out using TransStartR Top Green qPCR SuperMix (TransGen Biotech, Beijing, China) and a SteponePlus Real-Time PCR system (Applied Biosystems, USA) to assess gene

expression. GAPDH was used as a reference for mRNA levels, and U6 was used as a reference for miRNA levels. The sequences of the primers used are listed in Supplementary Table 1. Each PCR

assay was repeated thrice. WESTERN BLOT Western blotting was performed as previously described16. All of the antibodies used in this article are listed in Supplementary Table 2.

DUAL-LUCIFERASE REPORTER GENE ASSAY Fragments of the wild-type (WT) or mutant (MUT) 3′UTR of PTPN4 containing miR-375 binding sites were subcloned into the P-MIR-Report firefly luciferase

vector. The sequence of pri-miR-375 was subcloned into the pCDH-CMV vector (pCDH-375). The cloning and mutation-introducing primers are listed in Supplementary Table 3. The WT or MUT firefly

luciferase vector along with the Renilla luciferase vector (used as a protein loading control) were cotransfected with pCDH-375 or pCDH-empty (negative control) vector into HEK-293 cells.

Forty-eight hours post-transfection, the cells were harvested and lysed. The luciferase activity of the lysate was detected with a Dual-Glo® Luciferase Assay System (Promega, Wisconsin,

USA). CELL TRANSFECTION To upregulate or downregulate the expression of miR-375, DU145 and PC-3 cells were transfected with pSUPER-RETRO-Puro-miR-375, pSUPER-RETRO-Puro-NC,

pHB-U6-MCS-PGK-PURO-miR-375 sponge (sp miR-375), and pHB-U6-MCS-PGK-PURO-NC (Hanbio Biotechnology, Shanghai, China) by using jetPRIME® (Polyplus-transfection® SA, Strasbourg, France). In

brief, cells were seeded into six-well plates for 24 h before transfection. When the cell confluence reached 50–80%, the cells were transfected using jetPRIME®. After the medium was changed

4 h later, the cells were cultured for another 20 hours and screened with puromycin (DU145 1.5 µg/mL; PC-3 1 µg/mL). Colonies containing more than 50–100 cells were isolated, propagated,

identified for the level of miR-375, and cultured for future use. For the rescue experiment, cells overexpressing miR-375 were transfected with pcDNA3.1-PTPN4 recombinant or pcDNA3.1-empty

plasmid (InvitrogenTM Life Technologies, California, America). In parallel with PTPN4 overexpression, cells with miR-375 knockdown were transfected with siPTPN4 or siNC (Hanbio

Biotechnology, Shanghai, China) by using jetPRIME®. The primers for subcloning and the target sequence of PTPN4 and the short interfering RNA targeting PTPN4 are presented in Supplementary

Table 4. CELL PROLIFERATION ASSAYS In the CCK-8 assays, transfected cells (5 × 103 cells/well) were seeded. Cell proliferation was detected at 24, 48, 72, and 96 h using a CCK-8 kit

(Dojindo, Kumamoto, Japan) following the manufacturer’s instructions. The absorbance at 450 nm was measured. Additionally, according to the manufacturer’s instructions, a Cell-Light TM EdU

Apollo 567 In Vitro kit (Ribobio, Guangzhou, China) was utilized to assay EdU incorporation in the cells. APOPTOSIS ANALYSIS Cells were harvested and washed three times, followed by

treatment with 5 µL Annexin V-FITC (Dojindo, Japan) and 5 µL PI for 15 min in the dark at room temperature. Apoptotic cells were fractioned by flow cytometry (BD FACSAriaTM II, New Jersey,

USA). CELL MIGRATION AND INVASION ASSAYS Cells (5 × 105/well) were maintained in six-well plates until they reached 100% confluence. A 10-µl pipette tip was applied to generate a wound, and

the cell layer was then washed to remove detached cells. Next, the cells were incubated in serum-free RPMI 1640 at 37 °C for 24 h. The wound was photographed under a microscope at 0 h and 24

 h, and the rate of closure was calculated with ImageJ software. For the transwell assay, miR-375 -overexpressing or miR-375-silenced DU145 and PC-3 cells (5 × 104) in serum-free RPMI 1640

were seeded into inner chambers with or without precoated Matrigel (Corning, New York, USA). RPMI 1640 containing 10% FBS was added to the outer chambers. After 16–24 h, the cells remaining

in the inner chamber were removed with a cotton swab, and the cells migrated through the pores were fixed with 4% paraformaldehyde for 1 h. After the cells were stained with crystal violet

for 1 hour, microscopic photographs were taken, and the number of migrated cells was counted. ENZALUTAMIDE SENSITIVITY ANALYSIS Cells (8 × 103 cells/well) were incubated overnight. Then,

they were exposed to different concentrations of enzalutamide (0, 1, 2, 4, 8, 16, 32, 64 µmol/L) and cultured for another 3 days. Cell viability was evaluated using a CCK-8 assay. ISOLATION

AND IDENTIFICATION OF HUCMSCS Fresh human umbilical cords were obtained from the Second Affiliated Hospital of Harbin Medical University with informed consent. Mesenchymal progenitor cells

were cultured in serum-free MesenCult-ACF Plus Medium (05448, STEMCELL, Canada) immediately after the umbilical cord had been harvested. After perivascular Wharton’s jelly was incubated in

5% CO2 at 37 °C for 10–14 days until the cells (P0) were confluent around the colonization point, the hucMSCs were passaged, and the hucMSCs at the 4th passage were used for further analysis

and experiments. Flow cytometry was used to detect the surface markers of the hucMSCs (refer to Supplementary Table 2 for the antibodies). To evaluate their potential for multiple

differentiation, hucMSCs were cultured and induced in osteogenic, adipogenic, and chondrogenic differentiation medium (Biological Industries, Israel) for 6–21 days, followed by Alizarin red

(MSC Osteo-Staining Kit, MC37C0-1.4, VivaCell Biosciences, China), Oil red O (MSC Adipo-Staining Kit, MC37A0-1.4, VivaCell Biosciences, China), and Alcian blue (MSC Chondro-Staining Kit,

MC37B0-1.4, VivaCell Biosciences, China) staining. EXOSOME ISOLATION AND CHARACTERIZATION The serum-free supernatants of P4 hucMSCs were centrifuged at 4000 × _g_ for 30 min, filtered

through a 0.22 µm filter, and ultracentrifuged at 100,000 × _g_ for 3 h at 4 °C (OptimaXPN-100 Ultracentrifuge). After the supernatant was removed, the pellet was suspended in PBS and

ultracentrifuged for 2 h. The collected exosomes were resuspended in PBS and stored at −80 °C before use. Flow NanoAnalyzer N30 (NanoFCM Inc., Xiamen, China) was used to determine the size

and concentration of exosomes. The morphological features of exosomes were detected with transmission electron microscopy (TEM; Hitachi 7500, Japan). Western blotting was used to assess

surface markers, including CD63 (ab134045, Abcam), CD81 (ab79559, Abcam), and TSG101 (ab125011, Abcam). CELLULAR UPTAKE OF PKH67-LABELED EXOSOMES To visualize the internalization of exosomes

in DU145 and PC-3 cells, exosomes were stained with PKH67 (MINI67-1KT, Sigma-Aldrich, USA) in Diluent C. The mixture was filtered with a diffusiometer (Centrifugal Filter Units, Merck KGaA,

Germany) to remove the excess dye. The PKH67-labeled exosomes were cocultured with DU145 and PC-3 cells for 24 h, followed by visualization under a confocal fluorescence microscope.

XENOGRAFT MODEL Four-week-old male BALB/c nude mice were obtained from Beijing Vital River Laboratory. A total of 4 × 106 DU145 cells stably transfected with empty vector (Vector), miR-375

expression vector (miR-375) or miR-375 sponge vector (sp miR-375) were mixed with Matrigel (1:1) and subcutaneously injected into the backs of mice (8 mice per group). One week later, the

mice were surgically castrated under anesthesia. When tumor volume were around ~50 mm3, each of the three groups of mice were again randomly stratified into two subgroups (4 mice per

subgroup): (1) Vector (95% corn oil+5% DMSO, ip, 200 µl), (2) Vector + enzalutamide (10 mg/kg, ip, 200 µl), (3) miR-375 (95% corn oil + 5% DMSO, ip, 200 µl), (4) miR-375+ enzalutamide (10 

mg/kg, ip, 200 µl), (5) sp miR-375 (95% corn oil+5% DMSO, ip, 200 µl), (6) sp miR 375+ enzalutamide (10 mg/kg, ip, 200 µl). Tumor size was measured twice a week, and the tumor volume was

calculated with the formula: tumor volume = length × width2 × 0.5. The mice were sacrificed 30 days after subcutaneous injection. A fraction of the tumor tissue was fixed in 4%

paraformaldehyde solution for hematoxylin and eosin (HE) and immunohistochemical staining analysis (IHC), and the rest was immediately stored at −80 °C for western blotting and real-time

PCR. For metastasis analysis, miR-375-overexpressing and miR-375-depleted DU145 cells (2 × 105/100 µl) were injected into the mice through the tail vein (_n_ = 4 per group). Eight weeks post

injection, the mice were euthanized, and the lungs were removed. The metastatic tumor foci in the lungs were visualized and quantified by fixing the lungs in 4% paraformaldehyde, paraffin

embedding the lungs and HE staining of serially sliced sections at 2 mm intervals. To evaluate the in vivo function of e-375i, 4 × 106/100 µl DU145 cells mixed with 100 µl Matrigel were

subcutaneously injected into the backs of mice. Three days after injection, the mice were randomized into two groups (_n_ = 5). Exosomes (1 × 109) carrying NC oligonucleotides (5 nmol, e-NC

group) or miR-375 antisense oligonucleotides (5 nmol, e-375i group) were intraperitoneally injected twice a week. Tumor volume and body weight were measured every 2 days until the mice were

sacrificed 30 days after inoculation. The excised tumors were partially soaked in 4% paraformaldehyde and embedded in paraffin for IHC, and the rest were immediately stored at −80 °C for

western blotting and real-time PCR. HE AND IHC STAINING The tissue sections were stained for H&E, and IHC for Ki-67, PTPN4, AR, E-cadherin and Vimentin was performed as previously

described17. Image-Pro Plus 6.0 was utilized to assess the average integrated optical density of the staining when the IHC images were loaded into the software. STATISTICAL ANALYSIS Data

analysis was performed using GraphPad Prism 8. The data are presented as the mean ± SEM. Student’s _t_ test or one-way analysis of variance was utilized to calculate statistical

significance. The association between miR-375 and Gleason score was statistically determined with the Kruskal-Wallis test and Dunn’s test. Statistical results with *_P_ < 0.05; **_P_ <

 0.01; ***_P_ < 0.001; ****_P_ < 0.0001 were statistically significant. RESULTS MIR-375 EXPRESSION WAS ABERRANTLY INCREASED IN PCA TISSUES After determining the high level of plasma

exosomal miR-375 in CRPC patients6, we investigated the possible origin of the circulating miR-375. RNAscope was carried out by using a miR-375-specific ISH probe in a PCa tissue chip, which

consists of 54 paracancerous and 93 cancer tissues. The representative ISH image is shown in Fig. 1a on the left. According to our grading criteria, the mean miR-375 level in PCa tissues

was up to sixfold higher than that in paracancerous tissues (1.50 ± 0.97 versus 0.26 ± 0.58, _P_ < 0.0001). Fig. 1a right). MiR-375 was also highly expressed in PCa-derived exosomes, as

evaluated by EvmiRNA (Supplementary Fig. 1a). In line with our RNAscope results, comparison using TCGA data and those in StarBase revealed that miR-375 was prominently overexpressed in PCa

tissues (Fig. 1b and c). The relationship between miR-375 and PCa patients’ cancer stages was evaluated in the TCGA database, revealing that miR-375 was positively associated with the

Gleason score (Supplementary Fig. 1b) and possessed high diagnostic power for PCa with an area under the curve of 0.963 (95% CI, 0.936–0.990, Supplementary Fig. 1c). The above evidence

indicated that the elevated plasma exosomal miR-375 in PCa patients was likely from cancerous tissue. We next aimed to clarify the roles of miR-375 in castration-resistant prostate cancer

progression and the extent to which miR-375 can serve as a therapeutic target; therefore, we chose two androgen-independent PCa cell lines, DU145, and PC-3, in which miR-375 was mildly

expressed9, for subsequent experiments. MIR-375 PROMOTED PCA DEVELOPMENT To investigate the role of miR-375 in the malignant characteristics of PCa cells, we overexpressed or knocked down

miR-375 in DU145 and PC-3 cells, respectively (Fig. 2a, Supplementary Fig. 2a). CCK-8 and EdU assays were performed to determine cell proliferation. As shown in Fig. 2b, c, upregulation of

miR-375 significantly promoted DU145 and PC-3 cell growth. Transwell and wound healing assays revealed that miR-375 overexpression facilitated migration and invasion (Fig. 2d, e) while

inhibiting apoptosis of PCa cells (Fig. 2f). These effects could be completely reversed when the miR-375 sponge was introduced into DU145 and PC-3 cell lines (Supplementary Fig. 2b–f). At

the molecular level, miR-375 overexpression promoted the expression of N-cadherin, Vimentin, MMP7, MMP9, and BCL2 suppressed E-cadherin and cleaved-PARP1 (Fig. 2g left, 2h left). This

expression signature could be substantially reversed when DU145 and PC-3 cells were transfected with a miR-375 sponge vector (Fig. 2g right, 2h right). The above results collectively

suggested that miR-375 could modulate the expression of EMT and apoptosis markers, which in turn promoted PCa development. MIR-375 TARGETED PTPN4 DIRECTLY To dissect the underlying

mechanisms of miR-375 in promoting PCa progression, we first determined the direct target of miR-375. By using five different target gene prediction databases, we identified 50 intersecting

genes (Fig. 3a, Supplementary Table 5) falling into three subgroups according to the cumulative weighted context++ score ranging from 0 to −0.1, between −0.1 and −0.2, and less than −0.2. We

randomly chose one gene from each subgroup (PTPN4, EIF4G3, and UBE3A) for downstream validation. The miR-375 binding site in the 3′UTR of PTPN4, EIF4G3 and UBE3A mRNA, predicted by

TargetScan, is presented in Fig. 3b and Supplementary Fig. 3a, b. As shown in Fig. 3c and Supplementary Fig. 3c, d, miR-375 only decreased the luciferase activity in HEK-293 cells

cotransfected with reporter vectors harboring wild type, but not the mutant, 3′-UTR of PTPN4, EIF4G3 and UBE3A mRNA (_P_ < 0.001, _P_ < 0.01 or _P_ < 0.001, respectively),

suggesting miR-375 directly targeted and inhibited these three genes. Of note, PTPN4 was suppressed in prostate cancer tissues in the UALCAN database (Fig. 3d), which was negatively

correlated with miR-375 expression, as illustrated in StarBase (Fig. 3e). Other than PTPN4, no statistical significance was found regarding EIF4G3 or UBE3A expression when prostate cancer

tissues were compared to normal tissues in the UALCAN database (Supplementary Fig. 3e). Moreover, no statistical significance was found between the expression of EIF4G3 or UBE3A and miR-375,

as evaluated in StarBase (Supplementary Fig. 3f). Regarding PC-3 and DU145 cells, qRT-PCR results demonstrated that only PTPN4 mRNA was significantly and reversely altered as miR-375 was

overexpressed and knocked down (Fig. 3f and Supplementary Fig. 3g, h). Likewise, protein levels of PTPN4 were reduced post miR-375 overexpression but increased upon miR-375 downregulation

(Fig. 3g). Therefore, we chose PTPN4, a pivotal tumor inhibitor18, for subsequent experiments. In the Human Protein Atlas, significantly depressed PTPN4 was also found in PCa tissues

compared with normal tissues (Supplementary Fig. 3i). To further verify the bioinformatic findings, we performed IHC in 17 benign prostate hyperplasia and 30 PCa tissues. Indeed, PTPN4 was

mainly located in the cytoplasm and had significantly higher expression in benign tissues than in PCa tissues (65.43 ± 28.07 versus 13.46 ± 5.39, _p_ < 0.0001; Fig. 3h). Genes with

similar expression patterns are generally acknowledged to be functionally related19. We next identified 100 PTPN4-related genes (Supplementary Table 6) in GEPIA and annotated their cellular

functions via GO analysis. We found that PTPN4, along with its similar genes, was putatively related to the production of miRNAs, involved in gene silencing by miRNAs and the negative

regulation of the cell cycle process (Supplementary Fig. 3j–l). In KEGG analysis, PTPN4 was significantly related to prostate cancer and miRNAs in cancer (Supplementary Fig. 3m). Together

with the finding that PTPN4 acts as a tumor inhibitor, it is suggested that miR-375 may play an important role in miRNA-mediated PCa progression by negatively regulating PTPN4. MIR-375

REGULATED PCA PROGRESSION VIA THE PTPN4-STAT3 PATHWAY To confirm that PTPN4 is a mediator accounting for miR-375-elicited tumor development, rescue assays were carried out. Figure 4a, g

shows that both the mRNA and protein levels of PTPN4, which had been suppressed by induction of miR-375, were recovered upon transfection of the PTPN4 expression vector in

miR-375-overexpressing DU145 and PC-3 cells. The promoting effects on cell proliferation, migration, and invasion and suppressing effect on apoptosis upon miR-375 overexpression were

significantly attenuated by overexpression of PTPN4 (Fig. 4b–f and Supplementary Fig. 4a–d). Overexpression of PTPN4 also rescued the expressional alteration of the apoptosis markers

(cleaved-PARP1 and BCL2) and EMT markers (E-cadherin, N-cadherin, Vimentin, MMP7, and MMP9) brought upon by enhanced miR-375 expression (Fig. 4g). In the case of potential artifacts, we

knocked down PTPN4 expression in PCa cells whose miR-375 expression was depleted with a sponge vector. After screening for the eligible siRNA molecule in the two cell lines, we selected

siPTPN4#1 for the following experiment because it displayed the best inhibition effect as shown in Supplementary Fig. 5a. Furthermore, the results in Supplementary Fig. 5b and h show that

both the mRNA and protein levels of PTPN4, which had been upregulated by inhibition of miR-375, were significantly inhibited upon transfection of siPTPN4#1 in miR-375-suppressed DU145 and

PC-3 cells. As shown in Supplementary Fig. 5c–g and Supplementary Fig. 6a–d, the inhibitory effects of miR-375 depletion on the progression of PCa were also rescued by PTPN4 silencing. STAT3

signaling is a pivotal downstream pathway that responds to PTPN4 phosphorylation20. Our GSEA results also revealed that PTPN4 function in PCa might be related to inactivation of the

JAK-STAT signaling pathway (Fig. 4h). Therefore, we proposed that the STAT3 pathway was involved in miR-375-modulated PCa progression. Indeed, overexpression of PTPN4 substantially reversed

the enhancing effect of miR-375 on p-STAT3 expression (Fig. 4g), while suppression of PTPN4 reversed the inhibited level of p-STAT3 that responded to miR-375 depletion (Supplementary Fig.

5h). These findings indicated that PTPN4 antagonized the function of miR-375, which was overexpressed in prostate cancer, by inhibiting the STAT3 pathway. MIR-375 PROMOTED PCA DEVELOPMENT IN

VIVO To confirm our in vitro findings, DU145 cells with miR-375 overexpression or depletion were used to establish a xenograft nude mouse model (Supplementary Fig. 6e). As illustrated in

Fig. 5a–d, upregulation of miR-375 notably facilitated PCa growth, whereas miR-375 depletion demonstrated the opposite effect in vivo. In line with our in vitro findings, our in vivo study

confirmed that miR-375 expression was strikingly enhanced in miR-375-overexpressing tumors and suppressed in miR-375-knockdown tumors (Fig. 5e), consistent with PTPN4 exhibiting the opposite

trend at both the mRNA and protein levels (Fig. 5f, g). Additionally, the expression of p-STAT3 and BCL2 was significantly increased, while cleaved PARP was decreased in response to miR-375

upregulation (Fig. 5g). The corroborating IHC analysis results showed that Ki67 expression was prominently enhanced in the miR-375-overexpressing group compared to the control group (Fig.

5h). In our pulmonary metastasis model, we did not find statistical significance regarding the metastatic nodules at the surface of the lung among all groups, and only mild to moderate

collapses were found in the vector control group or miR-375 group (Supplementary Fig. 6f). However, scrutinizing the discontinuous lung sections and HE staining, we found obvious increases

both in numbers and in the area of the metastatic foci in the miR-375-overexpressing tumor compared to the vector control tumor (Fig. 5i, j). Furthermore, in Fig. 5j, the IHC assay showed

that PTPN4 and E-cadherin expression were markedly decreased, while Vimentin expression was increased upon miR-375 overexpression. All of the above effects elicited by miR-375 overexpression

were substantially reversed when miR-375 was depleted in the miR-375 sponge tumors, which confirmed our in vitro studies on metastasis and the direct modulating role of miR-375 on PTPN4.

HUCMSC-DERIVED EXOSOMES CARRYING MIR-375 ANTISENSE PMO (E-375I) INHIBITED PCA PROGRESSION IN VITRO AND IN VIVO To test whether exosomes can efficiently transport miR-375 antisense PMO into

target cells and counter miR-375 function, hucMSCs were grown in serum-free medium and characterized by tri-lineage differentiation assays and the signature of surface markers at the 4th

passage (Supplementary Fig. 7a, b). Exosomes with diameters of 30–150 nm, as determined by TEM, were isolated from the supernatant of the cell culture (Supplementary Fig. 7c). After their

size distribution and concentration were determined by NanoFlow (Supplementary Fig. 7d), exosome-specific markers were further verified with western blotting (Supplementary Fig. 7e). The

exosomes were coincubated with miR-375 antisense PMO to form the e-375i complex at room temperature. Next, we determined whether the miR-375i PMO could be transferred into PCa cells by

exosomes. As shown in Supplementary Fig. 7f, PKH67-labeled exosomes (green) could be efficiently internalized by PCa cells. Treatment with e-375i significantly inhibited miR-375 levels and

p-STAT3 but upregulated PTPN4 in a dose-dependent manner (Fig. 6a–c). E-375i also significantly reduced PCa cell proliferation, migration, and invasion while promoting apoptosis (Fig. 6d–h).

Moreover, e-375i treatment restrained the expression of N-cadherin, Vimentin, MMP7, MMP9 and BLC2 but upregulated the expression of PTPN4, E-cadherin and cleaved-PARP1 (Fig. 6i). The

effects of e-375i derived from DU145 cells could also be duplicated in PC-3 cells (Supplementary Fig. 8a–f). Therefore, our results demonstrated that miR-375 antisense PMOs could be

transported into PCa cells by exosomes and that e-375i significantly inhibited PCa development in vitro. To test the in vivo effects of e-375i, a xenograft model was established (Fig. 7a).

During the follow-up, the body weight of the animals remained stable as the tumors were regularly treated with e-375i (Fig. 7b). The tumor size and weight were markedly decreased (Fig.

7c–f), suggesting that e-375i was safe and effective in vivo for therapeutic purposes. Moreover, in the e-375i-treated tumors, miR-375 level depletion was sustained (Fig. 7g), while the

PTPN4 level was markedly increased at both the protein and mRNA levels (Fig. 7h–j). Consistent with the results in Fig. 6i, e-375i treatment resulted in reduced expression of p-STAT3 and

BCL2, increased cleaved-PARP1, and significantly decreased Ki67 in tumor tissue (Fig. 7i, j). Overall, e-375i was capable of regulating the PTPN4/STAT3 pathway and continuously suppressing

PCa cell proliferation both in vitro and in vivo. MIR-375 REGULATED ENZALUTAMIDE RESISTANCE VIA THE PTPN4-STAT3 PATHWAY It has been reported that androgen receptor (AR), the key player in

PCa resistance to the second-generation AR antagonist enzalutamide21, is a downstream effector of STAT3 signaling22. Although the mainstream view is that DU145 and PC-3 cells are devoid of

AR expression23, a study solidified the positive expression of AR in the two cell lines24. Likewise, as illustrated in Fig. 8a, b, we also observed mild expression of AR protein and mRNA in

DU145 and PC-3 cells, whose levels could be increased upon miR-375 overexpression but decreased upon miR-375 inhibition (Fig. 8c). Additionally, in these cell lines, PTPN4 overexpression

reversed miR-375-induced AR upregulation (Fig. 8d); PTPN4 inhibition reversed miR-375 suppression-induced AR downregulation (Fig. 8e). Notably, in vitro application of e-375i also restrained

AR expression (Fig. 8f). We next investigated the factors that contributed to AR expression changes after miR-375 introduction. First, we checked whether miR-375 modulated AR expression at

the transcriptional level by qRT-PCR. We found that when miR-375 was overexpressed, the level of AR mRNA was significantly increased and vice versa (Fig. 8g, h). In accordance with our

observations, data from StarBase revealed that miR-375 was positively correlated with AR (Fig. 8i). Based on the data derived from 52 pairwise PCa specimens in the TCGA database, both

miR-375 and AR mRNA were remarkably upregulated in PCa cancerous tissues compared with matched normal tissues (Fig. 8j, k). Next, we found that forced expression of PTPN4 was able to

substantially reverse the enhancing effect of miR-375 on AR mRNA (Fig. 8l), while inhibition of PTPN4 was able to reverse the suppression effect of miR-375 depletion on AR mRNA (Fig. 8m). As

expected, e-375i treatment attenuated the expression of AR mRNA (Fig. 8n). Our in vitro findings confirmed that AR was significantly enhanced in miR-375-overexpressing tumors but decreased

in miR-375-knockdown tumors (Fig. 8o). The western blot-based readouts were further corroborated by the IHC assay results (Fig. 8p). In the e-375i-treated PCa tumors, significantly reduced

AR expression (Fig. 8q, r) was observed, consistent with the in vitro results shown in Fig. 8f. We next asked whether miR-375 targeted PTPN4/STAT3 and facilitated resistance to AR

antagonists in PCa. Figure 9a–d shows that miR-375-overexpressing DU145 and PC-3 cells were more resistant to enzalutamide, while miR-375 knockdown enhanced their sensitivity. In parallel,

PTPN4 overexpression in PCa cells reversed the miR-375-induced insensitivity (Fig. 9e, f) with downregulation of p-STAT3 (Fig. 4g), while PTPN4 depletion in PCa cells reversed the miR-375

inhibition-enhanced sensitivity (Fig. 9g, h), and e-375i also significantly reduced PCa cell enzalutamide resistance (Fig. 9i, j). In the DU145 xenograft nude mouse model (Fig. 9k),

treatment consisting of enzalutamide and a miR-375 sponge led to the most significant inhibitory effects, as evidenced by decreased tumor sizes, tumor masses, and tumor volumes (Fig. 9l–o).

The above findings collectively support the notion that miR-375 enhances AR expression through PTPN4/STAT3 signaling, manipulating AR expression changes sensitivity to androgen antagonists,

even in androgen-independent PCa cells. DISCUSSION MiR-375 functions in a tissue- and organ-specific pattern in cancer. Recent studies have demonstrated that miR-375 functions as a tumor

suppressor in some cancers25,26,27,28,29. In PCa, Kunz et al. found that transfection of miR-375 ASOs inhibited PCa cell growth, indicating that miR-375 is an oncomiR30. Interestingly, the

exact function of miR-375 remains controversial even in the same PCa cell line across different studies. For example, one study indicated that ectopic expression of miR-375 promoted PC-3

apoptosis and inhibited cell viability9, while another study demonstrated that miR-375 enhanced PC-3 proliferation, migration, and invasion31. In this study, the gain- and loss-of-function

(either by miR-375 sponge or by miR-375 antisense PMO) reciprocally revealed the important roles of miR-375 in PCa. The gain-of-function assays showed that stable upregulation of miR-375 in

PCa cells promoted proliferation, migration, invasion, and enzalutamide resistance and inhibited apoptosis; on the other hand, the loss-of-function assays confirmed the results of the

gain-of-function assays. Our results clearly suggested that miR-375 served as an oncomiR in prostate cancer. This argument is further supported by the following evidence: 1) bioinformatics

analysis illustrating that miR-375 was enriched in prostate cancer compared with normal tissues; 2) positive association of miR-375 with tumor Gleason score; 3) the significantly higher

levels of miR-375 in the PCa tissues and in the serum of PCa patients compared to benign prostate hyperplasia32. Accumulating evidence has revealed that miR-375 can impact the progression of

prostate cancer by inhibiting different target genes33,34. For example, Selth et al. showed that miR-375 suppressed the invasion and migration of prostate cancer cells by targeting YAP1 and

ZEB1 and that inhibiting the transcription of miR-375 could reverse these effects33. Moreover, Choi et al. demonstrated that miR-375, miR-93, and miR-106b coregulate the CIC-CRABP1 axis to

facilitate the progression of prostate cancer35. For the first time, we identified PTPN4 as a novel direct target of miR-375. Our results demonstrated that both the protein and mRNA levels

of PTPN4 were reduced in response to miR-375 overexpression but increased after miR-375 downregulation. PTPN4 is a member of the protein tyrosine phosphatase (PTP) family36. Liu et al.

reported that miR-15b-5p possibly promoted tumorigenesis by binding to PTPN4 and activating the STAT3 signaling pathway18. By GSEA, we found that PTPN4 was negatively correlated with the

STAT3 pathway. This result was consistent with the report where loss of PTPN4 promoted STAT3 activity and accelerated the growth of rectal cancer20. STAT3 is a key player in the JAK/STAT

pathway37,38. A number of studies have indicated that the excessive activation of STAT3 can prevent tumor cells from undergoing apoptosis and facilitate cell proliferation, invasion, and

migration39,40. For example, Hashemi et al. recapitulated that inhibiting the p68/STAT3 pathway could suppress tumor growth, colony formation and migration41. Chen et al. found that STAT3

contributed to GC progression and poor prognosis via lncRNA HAGLROS/mTOR42. Our results demonstrated that upregulation of PTPN4 was able to attenuate the promoting effect of miR-375 on

p-STAT3, suggesting that the PTPN4/STAT3 signaling axis accounted for one pathway through which miR-375 regulated PCa cell proliferation, migration, invasion, and apoptosis. ASOs synthesized

with PMOs can quickly and efficiently inhibit their miRNA counterpart, holding therapeutic potential for different diseases when a specific miRNA is overexpressed43. However, the electric

neutral property of PMOs makes it very difficult for them to be transported into target cells by conventional cationic liposomes. This dilemma is largely resolved by the newly emerged

vehicle hucMSC-derived exosomes. HucMSCs are a more favorable source of exosomes than other cells because hucMSCs can continually produce a large number of exosomes44,45. Jia et al. noted

that hucMSC-derived exosomes loaded with miR-139-5p inhibited bladder tumorigenesis in vivo46. We utilized hucMSC exosomes carrying miR-375-interfering PMO oligomer (e-375i) to silence

miR-375 in PCa cells and found that systematic administration of e-375i could efficiently enter PCa cells, knock down miR-375, upregulate PTPN4, and downregulate p-STAT3, eventually blocking

the growth of PCa in vivo and in vitro. Aberrant AR signaling plays a major role in CRPC development, which may gradually lead to the development of enzalutamide resistance47. One study

showed that CREB5 enhanced AR activity and promoted PCa resistance to AR antagonists and androgen deprivation treatment48, which indicates the possible benefits of interfering with AR in

CRPC treatment. Indeed, galiellalactone can suppress enzalutamide-resistant PCa by inhibiting the STAT3/AR signaling axis22. In this study, PCa cells with miR-375 overexpression were more

resistant to enzalutamide with increased AR expression, whereas miR-375 depletion could induce the opposite effects. These results were notably consistent with previous reports9,49.

Furthermore, PTPN4 overexpression reversed miR-375-induced insensitivity to enzalutamide in DU145 and PC-3 cells with a reduction in p-STAT3 and AR expression. Our study recapitulated for

the first time that miR-375/PTPN4/STAT3 is an alternative axis facilitating enzalutamide resistance. Interestingly, it has been reported that AR overexpression can upregulate miR-375

expression by modulating the miR-375 promoter methylation status49. Therefore, miR-375 is likely to enhance enzalutamide resistance through a positive regulatory loop involving the

PTPN4/STAT3/AR axis. Disrupting this loop is especially attractive and promising for PCa treatment, especially for patients whose AR level is high. It is worth noting that the AR-negative

state of DU145 and PC-3 cell lines, suggested by some recent literature50,51, is a technical artifact rather than a theoretical reality. Technically, western blotting is applied to evaluate

AR expression using cell lysates prepared from PCa lines that traditionally include LNCaP cells, where AR expression is very high. When the protein-transferred membrane is developed with an

autoexposure platform, the signal of the AR band in the LNCaP lane will be so robust as to mandatorily shorten the exposure time, eventually making PC-3 and DU145 lines appear to be devoid

of AR expression. Similar results were repeatedly obtained in our study as we screened the cell lines, where AR bands in PC-3 and DU145 lanes could only be distinctively detected upon

over-developing conditions when LNCaP protein was also included (Fig. 8a). In addition to the AR reference, the volume of loaded protein may be another reason for the artifact during western

blotting. Many researchers, including technical experts from pharmaceutical companies, load 10–15 μg of total protein to detect specific targets. In our experiment, the AR signal could not

be detected when the protein was sampled at concentrations lower than 25 μg. In support of our findings, positive expression of AR in both PC-3 and DU145 cells has been identified in many

other studies52,53. In particular, Alimirah et al., whose study was specifically performed to determine AR expression in various PCa cells, clearly demonstrated the moderate expression of AR

in PC-3 and DU145 lines24. Collectively, substantial evidence has fully established that PC-3 and DU145 cells are AR positive. Despite the above findings, this study also has some

limitations. For example, an essential prerequisite for the universal application of e-375i in the clinic is that miR-375 universally promotes the progression of PCa, including

castration-resistant and castration-sensitive PCa. Thus, we should extend our research from AR-insensitive to AR-sensitive PCa cells, as well as PCa organoids. In addition, we found in the

current study that miR-375 can inhibit apoptosis and promote drug resistance in PCa. Whether the inhibited apoptotic property is the main cause of the drug-resistant phenotype of PCa remains

to be fully elucidated. Identification of the miR-375-regulated gene network may contribute to addressing this issue. In summary, this is the first proof of principle study that shows that

miR-375 can facilitate prostate cancer progression and enzalutamide resistance via the PTPN4/STAT3 pathway. HucMSC-derived exosomes loaded with specific antisense PMO oligomers dramatically

reversed the effect of aberrantly expressed miR-375 (Fig. 10). Our findings indicate that miR-375 could serve as a novel therapeutic target for CRPC and that hucMSC-derived exosomes may

serve as a safe and efficient vehicle in gene therapy. REFERENCES * Sung, H. et al. Global cancer statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in

185 countries. _CA Cancer J. Clin._ 71, 209–249 (2021). PubMed  Google Scholar  * Han, Q. et al. Targeted inhibition of SIRT6 via engineered exosomes impairs tumorigenesis and metastasis in

prostate cancer. _Theranostics_ 11, 6526–6541 (2021). Article  CAS  PubMed  PubMed Central  Google Scholar  * Han, Y. et al. Triptolide inhibits the AR signaling pathway to suppress the

proliferation of enzalutamide resistant prostate cancer cells. _Theranostics_ 7, 1914–1927 (2017). Article  CAS  PubMed  PubMed Central  Google Scholar  * Wang, Y. et al. Mechanisms of

enzalutamide resistance in castration-resistant prostate cancer and therapeutic strategies to overcome it. _Br. J. Pharmacol._ 178, 239–261 (2021). Article  CAS  PubMed  Google Scholar  *

Mollaei, H., Safaralizadeh, R. & Rostami, Z. MicroRNA replacement therapy in cancer. _J. Cell Physiol._ 234, 12369–12384 (2019). Article  CAS  PubMed  Google Scholar  * Huang, X. et al.

Exosomal miR-1290 and miR-375 as prognostic markers in castration-resistant prostate cancer. _Eur. Urol._ 67, 33–41 (2015). Article  CAS  PubMed  Google Scholar  * Bhagirath, D. et al.

MicroRNA determinants of neuroendocrine differentiation in metastatic castration-resistant prostate cancer. _Oncogene_ 39, 7209–7223 (2020). Article  PubMed  PubMed Central  CAS  Google

Scholar  * Wang, Y. et al. miR-375 induces docetaxel resistance in prostate cancer by targeting SEC23A and YAP1. _Mol. Cancer_ 15, 70 (2016). Article  PubMed  PubMed Central  CAS  Google

Scholar  * Costa-Pinheiro, P. et al. MicroRNA-375 plays a dual role in prostate carcinogenesis. _Clin. Epigenet._ 7, 42 (2015). Article  CAS  Google Scholar  * Chen, Z. et al.

microRNA-6785-5p-loaded human umbilical cord mesenchymal stem cells-derived exosomes suppress angiogenesis and metastasis in gastric cancer via INHBA. _Life Sci._ 284, 119222 (2021). Article

  CAS  PubMed  Google Scholar  * Liang, G. et al. Engineered exosomes for targeted co-delivery of miR-21 inhibitor and chemotherapeutics to reverse drug resistance in colon cancer. _J.

Nanobiotechnol._ 18, 10 (2020). Article  CAS  Google Scholar  * Han, S. et al. Delivery of anti-miRNA-221 for colorectal carcinoma therapy using modified cord blood mesenchymal stem

cells-derived exosomes. _Front. Mol. Biosci._ 8, 743013 (2021). Article  CAS  PubMed  PubMed Central  Google Scholar  * Wolfe, J. M. et al. Machine learning to predict cell-penetrating

peptides for antisense delivery. _Acs. Cent. Sci._ 4, 512–520 (2018). Article  CAS  PubMed  PubMed Central  Google Scholar  * Lobo, S., Pereira, C., Oliveira, C. & Almeida, G. M.

Skipping Exon-v6 from CD44v6-containing isoforms influences chemotherapy response and self-renewal capacity of gastric cancer cells. _Cancers_ 12, 2378 (2020). Article  CAS  PubMed Central 

Google Scholar  * Ma, W. et al. Inhibition of p53 expression by peptide-conjugated phosphorodiamidate morpholino oligomers sensitizes human cancer cells to chemotherapeutic drugs. _Oncogene_

31, 1024–1033 (2012). Article  CAS  PubMed  Google Scholar  * Gan, J. et al. The influence of photodynamic therapy on the Warburg effect in esophageal cancer cells. _Lasers Med. Sci._ 35,

1741–1750 (2020). Article  PubMed  Google Scholar  * Liu, C. et al. Blocking IL-17A enhances tumor response to anti-PD-1 immunotherapy in microsatellite stable colorectal cancer. _J.

Immunother. Cancer_ 9, e001895 (2021). Article  PubMed  PubMed Central  Google Scholar  * Liu, X., Dong, Y. & Song, D. Inhibition of microRNA-15b-5p attenuates the progression of oral

squamous cell carcinoma via modulating the PTPN4/STAT3 axis. _Cancer Manag. Res._ 12, 10559–10572 (2020). Article  CAS  PubMed  PubMed Central  Google Scholar  * Tang, Z. et al. GEPIA: a web

server for cancer and normal gene expression profiling and interactive analyses. _Nucleic Acids Res._ 45, W98–W102 (2017). Article  CAS  PubMed  PubMed Central  Google Scholar  * Zhang, B.

D. et al. Loss of PTPN4 activates STAT3 to promote the tumor growth in rectal cancer. _Cancer Sci._ 110, 2258–2272 (2019). Article  CAS  PubMed  PubMed Central  Google Scholar  * Gao, L. et

al. KIF15-mediated stabilization of AR and AR-V7 contributes to enzalutamide resistance in prostate cancer. _Cancer Res._ 81, 1026–1039 (2021). Article  CAS  PubMed  Google Scholar  *

Thaper, D. et al. Galiellalactone inhibits the STAT3/AR signaling axis and suppresses Enzalutamide-resistant Prostate Cancer. _Sci. Rep._ 8, 17307 (2018). Article  PubMed  PubMed Central 

CAS  Google Scholar  * Sampson, N. et al. Inhibition of Nox4-dependent ROS signaling attenuates prostate fibroblast activation and abrogates stromal-mediated protumorigenic interactions.

_Int. J. Cancer_ 143, 383–395 (2018). Article  CAS  PubMed  PubMed Central  Google Scholar  * Alimirah, F., Chen, J., Basrawala, Z., Xin, H. & Choubey, D. DU-145 and PC-3 human prostate

cancer cell lines express androgen receptor: implications for the androgen receptor functions and regulation. _FEBS Lett._ 580, 2294–2300 (2006). Article  CAS  PubMed  Google Scholar  * Wu,

Y., Sun, X., Song, B., Qiu, X. & Zhao, J. MiR-375/SLC7A11 axis regulates oral squamous cell carcinoma proliferation and invasion. _Cancer Med._ 6, 1686–1697 (2017). Article  CAS  PubMed

  PubMed Central  Google Scholar  * Jayamohan, S. et al. Dysregulation of miR-375/AEG-1 axis by human papillomavirus 16/18-E6/E7 promotes cellular proliferation, migration, and invasion in

cervical cancer. _Front. Oncol._ 9, 847 (2019). Article  PubMed  PubMed Central  Google Scholar  * Xu, X. et al. miR-375-3p suppresses tumorigenesis and partially reverses chemoresistance by

targeting YAP1 and SP1 in colorectal cancer cells. _Aging_ 11, 7357–7385 (2019). Article  CAS  PubMed  PubMed Central  Google Scholar  * He, Z., Li, W., Zheng, T., Liu, D. & Zhao, S.

Human umbilical cord mesenchymal stem cells-derived exosomes deliver microRNA-375 to downregulate ENAH and thus retard esophageal squamous cell carcinoma progression. _J. Exp. Clin. Cancer

Res._ 39, 140 (2020). Article  CAS  PubMed  PubMed Central  Google Scholar  * Xu, X. et al. Selective exosome exclusion of miR-375 by glioma cells promotes glioma progression by activating

the CTGF-EGFR pathway. _J. Exp. Clin. Cancer Res._ 40, 16 (2021). Article  CAS  PubMed  PubMed Central  Google Scholar  * Kunz, M. et al. Nanoparticle-complexed antimiRs for inhibiting tumor

growth and metastasis in prostate carcinoma and melanoma. _J. Nanobiotechnol._ 18, 173 (2020). Article  CAS  Google Scholar  * Pickl, J. M. et al. Ago-RIP-Seq identifies Polycomb repressive

complex I member CBX7 as a major target of miR-375 in prostate cancer progression. _Oncotarget_ 7, 59589–59603 (2016). Article  PubMed  PubMed Central  Google Scholar  * Abramovic, I. et

al. MiR-182-5p and miR-375-3p have higher performance than PSA in discriminating prostate cancer from benign prostate hyperplasia. _Cancers_ 13, 2068 (2021). Article  CAS  PubMed  PubMed

Central  Google Scholar  * Selth, L. A. et al. A ZEB1-miR-375-YAP1 pathway regulates epithelial plasticity in prostate cancer. _Oncogene_ 36, 24–34 (2017). Article  CAS  PubMed  Google

Scholar  * Pillman, K. A. et al. miR-200/375 control epithelial plasticity-associated alternative splicing by repressing the RNA-binding protein Quaking. _Embo j._ 37, e99016 (2018). Article

  PubMed  PubMed Central  CAS  Google Scholar  * Choi, N. et al. miR-93/miR-106b/miR-375-CIC-CRABP1: a novel regulatory axis in prostate cancer progression. _Oncotarget_ 6, 23533–23547

(2015). Article  PubMed  PubMed Central  Google Scholar  * Caillet-Saguy, C. et al. Regulation of the human phosphatase PTPN4 by the inter-domain linker connecting the PDZ and the

phosphatase domains. _Sci. Rep._ 7, 7875 (2017). Article  PubMed  PubMed Central  CAS  Google Scholar  * Jin, W. Role of JAK/STAT3 signaling in the regulation of metastasis, the transition

of cancer stem cells, and chemoresistance of cancer by epithelial-mesenchymal transition. _Cells_ 9, 217 (2020). Article  CAS  PubMed Central  Google Scholar  * Johnson, D. E., O’Keefe, R.

A. & Grandis, J. R. Targeting the IL-6/JAK/STAT3 signalling axis in cancer. _Nat. Rev. Clin. Oncol._ 15, 234–248 (2018). Article  CAS  PubMed  PubMed Central  Google Scholar  * Hua, K.

et al. Long noncoding RNA HOST2, working as a competitive endogenous RNA, promotes STAT3-mediated cell proliferation and migration via decoying of let-7b in triple-negative breast cancer.

_J. Exp. Clin. Cancer Res._ 39, 58 (2020). Article  PubMed  PubMed Central  CAS  Google Scholar  * Yang, L. et al. Novel activators and small-molecule inhibitors of STAT3 in cancer.

_Cytokine Growth Factor Rev._ 49, 10–22 (2019). Article  CAS  PubMed  Google Scholar  * Hashemi, V. et al. Silencing of p68 and STAT3 synergistically diminishes cancer progression. _Life

Sci._ 249, 117499 (2020). Article  CAS  PubMed  Google Scholar  * Chen, J. F. et al. STAT3-induced lncRNA HAGLROS overexpression contributes to the malignant progression of gastric cancer

cells via mTOR signal-mediated inhibition of autophagy. _Mol. Cancer_ 17, 6 (2018). Article  PubMed  PubMed Central  CAS  Google Scholar  * Bajan, S. & Hutvagner, G. RNA-based

therapeutics: from antisense oligonucleotides to miRNAs. _Cells_ 9, 137 (2020). Article  CAS  PubMed Central  Google Scholar  * Wang, Y. et al. miR-224-5p carried by human umbilical cord

mesenchymal stem cells-derived exosomes regulates autophagy in breast cancer cells via HOXA5. _Front. Cell Dev. Biol._ 9, 679185 (2021). Article  PubMed  PubMed Central  Google Scholar  *

Yao, Z. et al. MicroRNA engineered umbilical cord stem cell-derived exosomes direct tendon regeneration by mTOR signaling. _J. Nanobiotechnol._ 19, 169 (2021). Article  CAS  Google Scholar 

* Jia, Y., Ding, X., Zhou, L., Zhang, L. & Yang, X. Mesenchymal stem cells-derived exosomal microRNA-139-5p restrains tumorigenesis in bladder cancer by targeting PRC1. _Oncogene_ 40,

246–261 (2021). Article  CAS  PubMed  Google Scholar  * Watson, P. A., Arora, V. K. & Sawyers, C. L. Emerging mechanisms of resistance to androgen receptor inhibitors in prostate cancer.

_Nat. Rev. Cancer_ 15, 701–711 (2015). Article  CAS  PubMed  PubMed Central  Google Scholar  * Hwang, J. H. et al. CREB5 promotes resistance to androgen-receptor antagonists and androgen

deprivation in prostate cancer. _Cell Rep._ 29, 2355–2370 (2019). Article  CAS  PubMed  PubMed Central  Google Scholar  * Chu, M. et al. Androgen receptor is negatively correlated with the

methylation-mediated transcriptional repression of miR-375 in human prostate cancer cells. _Oncol. Rep._ 31, 34–40 (2014). Article  CAS  PubMed  Google Scholar  * Fragni, M. et al.

Abiraterone acetate exerts a cytotoxic effect in human prostate cancer cell lines. _Naunyn Schmiedebergs Arch. Pharm._ 392, 729–742 (2019). Article  CAS  Google Scholar  * Wang, Z. et al.

ELL2 is required for the growth and survival of AR-negative prostate cancer cells. _Cancer Manag. Res._ 12, 4411–4427 (2020). Article  CAS  PubMed  PubMed Central  Google Scholar  *

Giatromanolaki, A. et al. CYP17A1 and androgen-receptor expression in prostate carcinoma tissues and cancer cell lines. _Curr. Urol._ 13, 157–165 (2019). Article  CAS  PubMed  PubMed Central

  Google Scholar  * Jacob, S. et al. Androgen receptor as a regulator of ZEB2 expression and its implications in epithelial-to-mesenchymal transition in prostate cancer. _Endocr. Relat.

Cancer_ 21, 473–486 (2014). Article  CAS  PubMed  Google Scholar  Download references ACKNOWLEDGEMENTS This work was supported by the National Natural Science Foundation of China (Grant Nos.

81572528, 82173184), Outstanding Youth Fund of Heilongjiang Province (Grant No. JC2018024), CSCO-Hengrui Tumor Research Fund (Y-HR2020ZD-0361) and Haiyan Fund of Harbin Medical University

Cancer Hospital (Grant Nos. JJZD2022-02, JJQN2019-06, JJQN2019-19). We are grateful to the Second Affiliated Hospital of Harbin Medical University for their kind generosity of fresh human

umbilical cords. AUTHOR INFORMATION AUTHORS AND AFFILIATIONS * Department of Medical Oncology, Harbin Medical University Cancer Hospital, Harbin, Heilongjiang, 150081, China Junqing Gan 

& Qingwei Meng * Biotherapy Center, Harbin Medical University Cancer Hospital, Harbin, Heilongjiang, 150081, China Shan Liu, Yu Zhang, Lu Bai, Ran Liao, Juan Zhao, Madi Guo, Wei Jiang, 

Jiade Li, Qi Li, Guannan Mu, Yangjiazi Wu, Xinling Wang, Xingli Zhang, Dan Zhou, Huimin Lv & Xiaoyi Huang * Department of Anesthesiology, Harbin Medical University Cancer Hospital,

Harbin, Heilongjiang, 150081, China Liangzi He * Department of Neurosurgery, the First Affiliated Hospital of Zhengzhou University, Zhengzhou, Henan, 450052, China Zhengfeng Wang *

Department of Gastrointestinal Medical Oncology, Harbin Medical University Cancer Hospital, Harbin, Heilongjiang, 150081, China Yanqiao Zhang * Department of Breast Surgery, Harbin Medical

University Cancer Hospital, Harbin, Heilongjiang, 150081, China Cheng Qian * Department of Pathology, Harbin Medical University Cancer Hospital, Harbin, Heilongjiang, 150081, China MeiYan

Feng * Department of Urologic Surgery, Harbin Medical University Cancer Hospital, Harbin, Heilongjiang, 150081, China Hui Chen * NHC Key Laboratory of Cell Transplantation, Harbin Medical

University, Harbin, Heilongjiang, 150081, China Xiaoyi Huang Authors * Junqing Gan View author publications You can also search for this author inPubMed Google Scholar * Shan Liu View author

publications You can also search for this author inPubMed Google Scholar * Yu Zhang View author publications You can also search for this author inPubMed Google Scholar * Liangzi He View

author publications You can also search for this author inPubMed Google Scholar * Lu Bai View author publications You can also search for this author inPubMed Google Scholar * Ran Liao View

author publications You can also search for this author inPubMed Google Scholar * Juan Zhao View author publications You can also search for this author inPubMed Google Scholar * Madi Guo

View author publications You can also search for this author inPubMed Google Scholar * Wei Jiang View author publications You can also search for this author inPubMed Google Scholar * Jiade

Li View author publications You can also search for this author inPubMed Google Scholar * Qi Li View author publications You can also search for this author inPubMed Google Scholar * Guannan

Mu View author publications You can also search for this author inPubMed Google Scholar * Yangjiazi Wu View author publications You can also search for this author inPubMed Google Scholar *

Xinling Wang View author publications You can also search for this author inPubMed Google Scholar * Xingli Zhang View author publications You can also search for this author inPubMed Google

Scholar * Dan Zhou View author publications You can also search for this author inPubMed Google Scholar * Huimin Lv View author publications You can also search for this author inPubMed 

Google Scholar * Zhengfeng Wang View author publications You can also search for this author inPubMed Google Scholar * Yanqiao Zhang View author publications You can also search for this

author inPubMed Google Scholar * Cheng Qian View author publications You can also search for this author inPubMed Google Scholar * MeiYan Feng View author publications You can also search

for this author inPubMed Google Scholar * Hui Chen View author publications You can also search for this author inPubMed Google Scholar * Qingwei Meng View author publications You can also

search for this author inPubMed Google Scholar * Xiaoyi Huang View author publications You can also search for this author inPubMed Google Scholar CORRESPONDING AUTHOR Correspondence to

Xiaoyi Huang. ETHICS DECLARATIONS COMPETING INTERESTS The authors declare no competing interests. ETHICAL APPROVAL AND CONSENT TO PARTICIPATE All human specimens were collected using the

protocol approved by the Ethics Review Committee at Harbin Medical University (approval number: 21-83). All relevant experimental procedures in nude mice were approved by the Institutional

Animal Care and Use Committee of the Center of Harbin Medical University (approval number: 17-18). ADDITIONAL INFORMATION PUBLISHER’S NOTE Springer Nature remains neutral with regard to

jurisdictional claims in published maps and institutional affiliations. SUPPLEMENTARY INFORMATION SUPPLEMENTARY FILE RIGHTS AND PERMISSIONS OPEN ACCESS This article is licensed under a

Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit

to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are

included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and

your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this

license, visit http://creativecommons.org/licenses/by/4.0/. Reprints and permissions ABOUT THIS ARTICLE CITE THIS ARTICLE Gan, J., Liu, S., Zhang, Y. _et al._ MicroRNA-375 is a therapeutic

target for castration-resistant prostate cancer through the PTPN4/STAT3 axis. _Exp Mol Med_ 54, 1290–1305 (2022). https://doi.org/10.1038/s12276-022-00837-6 Download citation * Received: 19

February 2022 * Revised: 31 May 2022 * Accepted: 27 June 2022 * Published: 30 August 2022 * Issue Date: August 2022 * DOI: https://doi.org/10.1038/s12276-022-00837-6 SHARE THIS ARTICLE

Anyone you share the following link with will be able to read this content: Get shareable link Sorry, a shareable link is not currently available for this article. Copy to clipboard Provided

by the Springer Nature SharedIt content-sharing initiative