
The minimal meningococcal proq protein has an intrinsic capacity for structure-based global rna recognition
- Select a language for the TTS:
- UK English Female
- UK English Male
- US English Female
- US English Male
- Australian Female
- Australian Male
- Language selected: (auto detect) - EN
Play all audios:

ABSTRACT FinO-domain proteins are a widespread family of bacterial RNA-binding proteins with regulatory functions. Their target spectrum ranges from a single RNA pair, in the case of
plasmid-encoded FinO, to global RNA regulons, as with enterobacterial ProQ. To assess whether the FinO domain itself is intrinsically selective or promiscuous, we determine in vivo targets
of _Neisseria meningitidis_, which consists of solely a FinO domain. UV-CLIP-seq identifies associations with 16 small non-coding sRNAs and 166 mRNAs. Meningococcal ProQ predominantly binds
to highly structured regions and generally acts to stabilize its RNA targets. Loss of ProQ alters transcript levels of >250 genes, demonstrating that this minimal ProQ protein impacts
gene expression globally. Phenotypic analyses indicate that ProQ promotes oxidative stress resistance and DNA damage repair. We conclude that FinO domain proteins recognize some abundant
type of RNA shape and evolve RNA binding selectivity through acquisition of additional regions that constrain target recognition. SIMILAR CONTENT BEING VIEWED BY OTHERS THE RNA-BOUND
PROTEOME OF MRSA REVEALS POST-TRANSCRIPTIONAL ROLES FOR HELIX-TURN-HELIX DNA-BINDING AND ROSSMANN-FOLD PROTEINS Article Open access 24 May 2022 THE CORE AND ACCESSORY HFQ INTERACTOMES ACROSS
_PSEUDOMONAS AERUGINOSA_ LINEAGES Article Open access 10 March 2022 IN VIVO RNA INTERACTOME PROFILING REVEALS 3’UTR-PROCESSED SMALL RNA TARGETING A CENTRAL REGULATORY HUB Article Open
access 07 December 2023 INTRODUCTION Global post-transcriptional regulatory networks involving a central RNA-binding protein (RBP) and hundreds of mRNAs and small regulatory RNAs (sRNAs)
have long been known in bacteria, centered on two RBP families, Csr/Rsm, and Hfq1. The recent discovery of ProQ as another global RPB in _Escherichia coli_ and _Salmonella enterica_2
demonstrated that additional such networks exist, at least in γ-proteobacteria. ProQ was found to target a distinct set of sRNAs and mRNAs rivaling the target regulons of CsrA or Hfq in
size3,4. ProQ activity affects diverse pathways including motility and pathogenesis2, and in _Salmonella_ this RBP is required for full virulence5. Many important aspects of ProQ biology
remain poorly understood, including the function of most associated sRNAs. Given the protein’s documented RNA chaperone activity6, these sRNAs may regulate mRNAs by base pairing mechanisms,
as recently demonstrated for ProQ-dependent repression of the synthesis of histone-like protein HU-α7. Also unknown is how ProQ recognizes its targets with specificity. UV-crosslinking
coupled with RNA-seq (UV CLIP-seq) in vivo has detected hundreds of ProQ sites in cellular transcripts but failed to reveal a common sequence motif4. In fact, this RBP seems novel in that it
may govern a global post-transcriptional network by recognizing RNA structure or shape rather than primary sequence. ProQ seems an unlikely candidate for a global RBP, as it belongs to the
PF04352 Pfam family of FinO-domain proteins whose other two characterized members—FinO and RocC—perform specialized functions with a small number of RNA targets8,9,10. The plasmid-encoded
FinO protein modulates conjugation in _E. coli_ via a single sRNA–mRNA pair, while RocC controls natural transformation in _Legionella pneumophila_ through one sRNA and four mRNAs of
competence genes11. This unusual variation in RNA target number for the same single RNA-binding domain (RBD) raises the fundamental question of whether high selectivity (FinO, RocC) or
global activity (ProQ) represents the major mode-of-action in this emerging RBP family. To address this, we here set out to determine the in vivo RNA target suite and physiological roles of
one of the smallest family members known (Fig. 1a), the ProQ protein of _Neisseria meningitidis_. The meningococcal ProQ (a.k.a. NMB1681 in _N. meninigitidis_ strain MC58) represents an
almost pure FinO domain, lacking the amino or carboxy terminal extensions carried by other family members8. Its crystal structure suggests a strong similarity to _E. coli_ ProQ8,12, and in
vitro assays with artificial RNA substrates have demonstrated RNA binding, strand-exchange and duplexing activities12. However, in contrast to the recently established role of Hfq as an
important RBP13,14 in _N. meningitidis_, neither the physiological role nor possible in vivo RNA targets of ProQ have been investigated in any β-proteobacterium. Here, we use in vivo UV
CLIP-seq and global gene expression profiling to draft a ProQ-RNA interaction landscape and analyse its functional overlap with the Hfq targetome in the meningococcus. We find that ProQ
interacts with >7% of all transcripts, both coding and noncoding, primarily at Rho-independent terminators. Our data indicate that ProQ stabilizes associated sRNAs and partially acts in
concert with Hfq. By phenotypic screening of a _proQ_ deletion mutant we identify a role for ProQ in DNA damage repair after UV light irradiation and oxidative stress responses. Together,
these results establish ProQ as a second global RBP in _N. meninigitidis_, an organism that possesses Hfq but lacks a translational repressor of the near-ubiquitous Csr/Rsm family.
Importantly, our findings also suggest conclusions as to the functional evolution of FinO domain proteins. RESULTS GENERAL CHARACTERISTICS OF THE MENINGOCOCCAL PROQ A comparison of ProQ-like
proteins annotated in diverse bacteria (Fig. 1a) identified the 15.5 kDa protein NMB1681 of _N. meningitidis_ as a particularly small member, lacking N-terminal or C-terminal sequences that
flank the central FinO domain in the well-characterized proteins FinO and ProQ of _E. coli_15 or RocC of _Legionella_11 (Fig. 1b). The amino acid sequence of NMB1681 shows sequence
conservation within the genus similar to housekeeping proteins in _Neisseria_ species (Supplementary Fig. 1 and Supplementary Table 1), arguing that the meningococcal ProQ protein carries
out important functions. Similarly, four out of nine residues reported to be essential for RNA regulation by RocC are conserved in the meningococcal ProQ (Fig. 1b). In the _N. meninigitidis_
model strain 8013 used here, the _proQ_ gene is expressed as a monocistronic ~473-nt mRNA (according to dRNA-seq data14) from the minus strand between _parE_ (topoisomerase IV subunit B)
and _aroC_ (chorismate synthase) (Fig. 1c). Western blot analysis revealed constitutive expression of ProQ in rich media comparable to that of Hfq (Fig. 1d). When grown in rich media (Fig.
1e), a _proQ_ deletion strain (strain Δ_proQ_) shows no difference from wild-type _N. meningitidis_, whereas an _hfq_ deletion strain (Δ_hfq_) exhibits a growth defect16. However, additional
knockout of _proQ_ (strain Δ_proQ_ Δ_hfq_) exacerbates the growth defect of the Δ_hfq_ mutant (Fig. 1e), which indicates a genetic condition to study ProQ-specific contributions to
physiology. Both gene deletions can be fully complemented by 3 × FLAG-tagged _hfq_ or _proQ_ genes integrated in the _lctP_-_aspC_ locus of strain _N. meninigitidis_ 8013, under control of
their native promoters (Fig. 1e and Supplementary Fig. 2). Taken together, the observed sequence conservation, expression level and growth phenotype argue for the physiological relevance of
ProQ in _N. meningitidis_ and likely other _Neisseria_ species as well. MENINGOCOCCAL PROQ IS A GLOBAL RBP To identify RNA ligands and binding sites of _N. meningitidis_ ProQ, we adopted an
in vivo UV CLIP-seq protocol3,4 for analysis of cross-linked RNA-protein complexes after UV light irradiation of live bacteria (Supplementary Figs. 3, 4a). Meningococci expressing C-terminal
3× FLAG tag ProQ from the native locus were grown in rich medium to late logarithmic phase, and cDNA obtained from immunopurified RNA-protein complexes were subjected to high-throughput
sequencing (Supplementary Data 1). Comparing the crosslinked samples to a non-crosslinked control, we identified 253 CLIP peaks associated with 166 mRNAs and 16 sRNAs (Fig. 2). The ProQ
sites were evenly distributed across both strands of the _N. meningitidis_ 8013 genome and included numerous genes important for meningococcal-host interactions (e.g., _iga_, _sodC_, _pilX_,
and _dsbA1_) and basic physiology (e.g., _carA_, _carB_, _comE1_, and _pnp_) (Fig. 2a). While most (78%) of the ProQ sites mapped to mRNAs (231 gene associations in 166 distinct mRNAs), we
also detected peaks in 16 validated sRNAs14 (Fig. 2b). Note that peaks can have multiple annotations if they overlap multiple features, e.g., CDSs and 3′UTRs. However, the majority of mRNAs
possess only one ProQ CLIP-peak (Fig. 2c), usually in their 3′UTR (Fig. 2a, b), while 66 and 8 binding sites mapped inside a CDS or 5′UTR, respectively (Fig. 2a, b). Of all categories used
(sRNA, tRNA, rRNA, 5′UTR, CDS, 3′UTR), sRNAs showed the highest fraction of bound transcripts relative to their number (Supplementary Fig. 4b). Importantly, there was no significant ProQ
binding in rRNAs and only 14 CLIP-peaks in tRNAs, despite the much higher expression of these RNAs. Altogether, the CLIP-seq analysis indicates that _N. meningitidis_ ProQ possesses a large
in vivo targetome comprising nearly 200 mRNAs and sRNAs. This identifies ProQ as the second global meningococcal RBP after Hfq. MENINGOCOCCAL PROQ BINDS TO STRUCTURED RNAS UV CLIP-peaks
often contain crosslink-induced mutations that identify contact regions of RBPs within target transcripts and can help identify RBP binding motifs17. Here, we observed cDNA mutations in 28%
(67/235) of ProQ peaks, the majority being T→C transitions (Fig. 2d, Supplementary Data 2). We used the MEME suite18 to search for an RNA motif associated with ProQ binding within a window
of 20 nucleotides around crosslink-induced mutations. However, MEME failed to identify any motif common to the majority ProQ binding regions. Restricting the MEME search to the 231 ProQ
peaks in mRNAs, however, did produce a significant consensus motif contained in 45 sequences (19.5%). This motif occurred in both CDS and 3′UTR peaks and was identical to the neisserial DNA
uptake sequence (DUS) motif ATGCCGTCTGAA19,20. Importantly, the genome of _N. meningitidis_ strain 8013 contains 1474 exact copies of the DUS and another 682 copies with one mismatch,
comprising 1.14% of the genome. There are only 19 DUS sequences in the 166 ProQ-bound mRNAs that do not overlap with a ProQ peak, but given the prevalence of this sequence in the genome it
is difficult to determine whether the observed DUS binding by ProQ is selective or due to chance. We do note that DUS sequences are overrepresented in Rho-independent terminators, so this
apparent preference for the DUS could be explained by a preference of ProQ for hairpin structures in 3′UTRs (Fig. 2b, e). Extensive secondary structures were also observed for ProQ sites in
mRNA 5′UTRs and in sRNAs, as illustrated in Fig. 2e. This preference of the meningococcal ProQ for RNA structure without a shared primary sequence echoes previous findings with the much
larger _Salmonella_ and _E. coli_ ProQ proteins4. DISTINCT TARGETOMES OF PROQ AND HFQ We have previously mapped the target suite of Hfq, the only other known global RBP in meningococci,
under the same growth condition14. Comparing the two targetomes, we observed different RNA binding preferences (Fig. 3a): ProQ binds significantly more frequently in 3′UTRs than Hfq (62% vs.
13%, _p_ < 0.001, two-sample test for equality of proportions with continuity correction), while Hfq shows more binding in CDSes (67% vs. 28%, _p_ < 0.001). These differing binding
preferences may have mechanistic implications for the effect of these RBPs on their target RNAs. A COG pathway comparison suggests that Hfq and ProQ each regulate a variety of biological
functions (Fig. 3b). Many of the 166 mRNAs with ProQ peaks are involved in energy metabolism (COG C: 10%) and translation (COG J: 10%), out of 194 COG annotated functions. On the other hand,
of the 401 Hfq-bound mRNAs14 over a third code for proteins of unknown function. Together, both RBPs target over a quarter (526) of the meningococcal mRNAs, with limited overlap (41 mRNAs
interact with both RBPs, Supplementary Data 3). A similar investigation of 33 RBP-binding sRNAs supports this view of largely distinct Hfq and ProQ targetomes. Only six sRNAs, including the
oxygen limitation-induced AniS21 and the human blood-induced Bns122, show peaks for both RBPs (Fig. 3c). In agreement with previous findings in _Salmonella_2, ProQ-associated sRNAs tend to
have more stable structures (i.e., lower folding free energy when normalized for length) than Hfq-associated sRNAs (Fig. 3d), again indicating that ProQ interactions are structure-driven. In
line with observations in _E. coli_ and _Salmonella_4, meningococcal ProQ sRNAs also tend to have shorter poly(U) tails compared to those bound by Hfq (Fig. 3e) although this difference was
not statistically significant. This suggests that competition between ProQ and Hfq for the same transcript may involve sequences upstream of the 3′ end. PROQ STABILIZES MRNAS AND SRNAS RPBs
such as ProQ and Hfq often affect the steady-state levels of their targets by altering RNA stability1. To address the effect of the meningococcal ProQ on target stability, we performed
northern blot analysis in the same growth condition as used for UV CLIP-seq analysis, selecting the _pnp_ mRNA where ProQ binds in the 5′UTR, the _rpmG_ RNA showing a ProQ peak in its CDS,
and the _sodC_ mRNA where ProQ targets the 3′UTR (Fig. 4a). All three mRNAs showed decreased steady-state levels in the Δ_proQ_ strain, as compared to wild-type, and were rescued to
wild-type levels by _proQ_ complementation (Fig. 4a, Supplementary Figs. 5–7). Similarly, rifampicin stability assays found decreased half-life for each mRNA in the absence of ProQ
(Supplementary Figs. 5–7). For instance, the half-life of the _sodC_ mRNA declined from 4 min in the wild-type strain to ~2 min in Δ_proQ_ (Fig. 4b, Supplementary Fig. 6). Based on these
three candidates, the mRNA half-life in the _proQ_ mutants was reduced on average by 53% (±17% standard error) compared to the wild-type (Supplementary Figs. 5–7). Next, we used an
electrophoretic mobility shift assay (EMSA) to measure ProQ affinity to these mRNAs in vitro. Each of these three mRNAs shifted in a concentration-dependent manner (Fig. 4d, Supplementary
Figs. 5–7). The binding of ProQ to these mRNAs as initially suggested by UV CLIP-seq and confirmed by EMSA, combined with a measurable stability effect, all strongly support that ProQ forms
complexes with these transcripts in vivo. We made similar observations for five selected sRNAs (AniS, Bns1, NMnc0006, NMnc0034 and NMnc0041), finding their steady-state levels were lower in
the absence of ProQ (Fig. 5a and Supplementary Fig. 8). Interestingly, NMnc0006 is the only intergenic sRNA that is exclusively associated with ProQ (Fig. 3c). It is an intergenic, highly
structured 188-nt sRNA with three detected ProQ sites (Fig. 2a, Supplementary Data 1). Rifampicin stability assays (Fig. 5b, Supplementary Figs. 9, 10) showed a decline in half-life from 4
min to ~1 min in the Δ_proQ_ strain, with _proQ_ complementation partially restoring it. Overall, we observed decreased stability for all ProQ-bound sRNAs tested in the Δ_proQ_ strain (Fig.
5c, Supplementary Figs. 8, 9a, 10a). We also tested several sRNAs by EMSA and consistently observed ProQ association in the high nanomolar range (Fig. 5d, Supplementary Fig. 9c).
Importantly, the ProQ-independent sRNA RcoF1 showed no shift with ProQ, confirming the specificity of these interactions (Fig. 5d Supplementary Fig. 9c). Half of these experimentally
confirmed ProQ-bound transcripts are also targeted by Hfq. Whereas _rpmG_ levels seem to be raised in the absence of Hfq (Fig. 4a), _sodC_ and _pnp_ steady-state levels are strongly reduced
in both _proQ_ and _hfq_ deletion strains. Generally, we did not observe a larger decrease in steady-state levels in the absence of both ProQ and Hfq, suggesting redundant functions of Hfq
and ProQ on targets that are bound by both RBPs (Fig. 4a). Exceptions include the AniS, Bns1, and NMnc0034 sRNAs whose steady-state levels in the Δ_proQ_Δ_hfq_ double-deletion strain were
lower than in the respective single deletion strains (Fig. 5a). Unfortunately, their lower steady-state levels in the absence of either RBP alone precludes meaningful half-life comparison
with the Δ_hfq_Δ_proQ_ strain (Supplementary Figs. 9b, 10b). This notwithstanding, our data show that ProQ directly affects the steady-state levels and the stability of meningococcal mRNAs
and sRNAs, largely independently of the other major meningococcal RNA chaperone, Hfq. PROQ GLOBALLY STABILIZES 3′UTRS OF MRNAS Our in vivo binding map and northern blot validations suggested
that ProQ plays a major role in meningococcal gene expression and 3′UTR regulation. To assess this on a genome-wide level and compare RNA-binding with steady-state levels, we subjected the
Δ_proQ_ mutant to RNA-seq analysis (Fig. 6, Supplementary Fig. 11, Supplementary Data 4). Absence of ProQ affected gene expression globally, changing the levels of 244 mRNAs, 12 sRNAs and
one tRNA (8.56% of genome, Fig. 6a, b, Supplementary Data 4). Although the affected mRNAs code for a wide range of functions, the major impact was seen on amino acid metabolism and transport
(COG E) and energy production and conversion (COG C) (Fig. 6c, Supplementary Data 5). Approximately 26% (60/229) of the transcripts with a ProQ peak (Supplementary Data 1 and 4) showed a
significant change in steady state levels compared to 8% (272/3383) without a ProQ peak, indicating (i) that ProQ has a significant effect on the expression of bound transcripts, and (ii)
numerous secondary effects on the expression of unbound transcripts. These may result from differential expression of global transcription regulators such as 6S RNA23, _σ_E sRNA24 and the
_nusA_/_nusB_ mRNAs25, all of which were differentially expressed in the Δ_proQ_ strain (Fig. 6a, Supplementary Data 4). Importantly, we also observed that ProQ-dependent changes in
transcript levels were associated with particular RNA features from the CLIP-peak analysis (Fig. 6b). While the steady-state levels across all CDSs, 5′UTRs and sRNAs with and without
ProQ-binding peaks were not significantly different, 3′UTRs with ProQ-binding peaks had significantly lower steady-state expression levels than 3′UTRs without ProQ CLIP-peaks. In line with
this, of the 244 mRNAs with differentially regulated RNA features, 159 mRNAs have downregulated 3′UTR regions (Fig. 6c). To assess whether ProQ can directly protect transcripts from
degradation at the RNA 3′end, we cloned and purified recombinant PNPase, a major 3′->5′ exonuclease in _N. meningitidis_, and used it in an in vitro RNA degradation assays. As shown in
Supplementary Fig. 12, PNPase efficiently degraded an in vitro transcribed _rpmG_ mRNA (whose 3′ end is recognized by ProQ). In contrast, degradation was strongly inhibited when this mRNA
was preincubated with ProQ protein. These data indicate that ProQ binding in 3′UTRs may act to stabilize the 3′UTR regions of mRNAs, while ProQ binding in 5′UTRs, CDS and sRNAs generally
does not impact RNA steady-state levels. PROQ IS REQUIRED FOR PROTECTION AGAINST DNA DAMAGE Previous work on FinO-domain proteins in other species has revealed effects on diverse pathways,
and in particular a link to stress response and genomic integrity8. Using this as a departure point, we assayed susceptibility of _N. meningitides_ Δ_proQ_ bacteria to oxidative stress as
caused by H2O2. We also included the Δ_hfq_ mutation, either alone or in combination with Δ_proQ_. All of these strains showed increased killing by UV light as compared to wild-type (Fig.
7a), and this also extended to killing by H2O2 (Fig. 7b). However, only the double deletion exhibited significantly impaired survival when stressed with paraquat (Fig. 7c). In order to
comprehensively investigate the influence of ProQ on the life-cycle of meningococci, in particular the transition from meningococcal colonization to invasive infection26,27,28, we employed
an array of established in vitro an ex vivo virulence assays that comprehensively model all major steps in the disease process. As depicted in Supplementary Fig. 13, deletion of ProQ had no
measurable effect on biofilm formation, adhesion, and invasion to human epithelial cell lines and polysaccharide capsule expression. Therefore, the primary physiological role of ProQ we
identified is in protecting against DNA damage, since H2O2 (via the Fenton reaction29) and short wave-length UV light are DNA-damaging agents. As inducing oxidative stress through H2O2
generation is a major antimicrobial strategy employed by professional phagocytes, ProQ may promote intracellular survival of meningococci and innate immune evasion during invasive disease.
One puzzling observation from these phenotypic assays is that complementation _in trans_ was inconsistent, and sometimes failed entirely, which is particularly evident in the H2O2 condition
(Fig. 7b). This heterogeneity in the ability of _trans_-expressed ProQ or Hfq proteins to restore wild-type physiology can also be seen in the steady-state level and RNA half-life
experiments above. As we currently lack a good explanation for this, other than that Hfq and ProQ levels may need to be tightly controlled, we believe that this variability is worthy of
further investigation. DISCUSSION The β-proteobacterium _N. meningitidis_ is a human-adapted commensal species and a leading cause of epidemic meningitis and sepsis worldwide26,28,30. Of
known global RBPs in bacteria, it lacks the ubiquitous Csr/Rsm− like RBP but has a functional Hfq with roles in many metabolic and stress pathways14,22,31 and bacterial survival in human
whole blood13. The data presented here clearly establish that β-proteobacteria possess another global RBP that not only has a large target suite and defined physiological roles, but also
governs its RNA regulon with only a FinO domain. Interestingly, whereas the target spectrum of bacterial Hfq proteins usually comprises dozens to hundreds of different RNA species3,14,32,33,
the targetome of FinO-domain containing proteins seems to be more variable4,11. Phylogenetic profiling further showed that all bacterial families without Hfq also lack FinO-domain
proteins8, suggesting that FinO-domain proteins have functions that are complementary to Hfq rather than substituting for this protein. In addition, while a subset of sRNAs and mRNAs are
bound by both ProQ and Hfq2, their binding seems to be mutually exclusive34. Echoing the results of recent UV CLIP-seq studies in _E. coli_ and _Salmonella_, the β-proteobacterial minimal
ProQ protein associates with highly structured sRNAs and binds mRNAs primarily at the 3′UTR. Given that bacterial post-transcriptional gene regulation has generally been associated with the
mRNA 5′UTR (where both translation and RNA decay are initiated), studies of ProQ promise the discovery of new molecular mechanisms associated with the 3′ end of mRNAs. Several mRNAs with
ProQ crosslinks in their 3′UTR such as _rpmG_ revealed decreased steady-state level in the _proQ_ deletion strain, especially in their 3′UTR regions (Figs. 2b, 4a, 6b, Supplementary Fig.
7), suggesting a role for ProQ in 3′ end-dependent protection from RNA degradation as described for ProQ in _Salmonella_4. Indeed, our in vitro results with purified _N. meningitidis_ PNPase
(Supplementary Fig. 12) support the notion that ProQ can protect against RNA decay at the 3′ end. In _Salmonella_, ProQ stabilizes some mRNAs by counteracting decay by the 3′ → 5′
exoribonuclease RNase II and endonuclease E by an unknown mechanism, possibly through steric hinderance of RNase II4. In _N. meningitidis_, an RNase E homolog is encoded by NMV_0215 and has
been shown to be essential by in vitro transposon mutagenesis16. However, nothing is known so far about what role RNase E may play in RNA turnover in _Neisseria_, and we did not find
NMV_0215 to be regulated by ProQ (Supplementary Data 1 and 4). While a 3′ → 5′ exoribonuclease RNase II is not annotated in _N. meningitidis_, the mRNA of the widely conserved 3′ → 5′
exoribonuclease _pnp_ is targeted by ProQ in its 5′UTR (Fig. 2a, Supplementary Data 1), resulting in higher transcript stability (Fig. 4a, Supplementary Fig. 5). Although _pnp_ expression
levels could only be partially restored by _proQ_ complementation (Fig. 4), this RNase is an interesting candidate for a potential regulatory feedback mechanism that measures protein
occupancy at mRNA ends (Supplementary Fig. 12). The association of meningococcal ProQ with 3′UTRs stands in clear contrast with Hfq, which preferentially binds mRNA leader sequences and a
distinct set of sRNAs (Fig. 3). However, we did identify a shared Hfq and ProQ targetome of 41 mRNAs and 6 sRNAs (Fig. 3, Supplementary Data 3). Along with the observation that a deletion of
ProQ leads to an additive growth phenotype with the _hfq_ knockout strain (Fig. 1e) these data suggest regulatory cross-talk between Hfq and ProQ at the post-transcriptional level, and
raise the possibility of functional dependence of the affected RNAs on both RBPs (Figs. 4, 5). The current literature is mixed on cross-talk between RBPs in bacteria. For example, in
_E.coli_ the sRNA McaS regulates biofilm formation through both Hfq and the carbon storage regulation chaperone CsrA35,36. However, in _Salmonell_a the RaiZ sRNA was initially identified as
an Hfq-associated sRNA via a RIP-seq screen37, but was later shown to depends exclusively on ProQ for both intracellular stability and mRNA target regulation7. Further experiments will be
necessary to understand the interplay of Hfq and ProQ on neisserial transcripts. Similarly to previous observations in _E. coli_ and _Salmonella_38,39,40, we detected reduced DNA damage
repair capacity and oxidative stress tolerance in _N. meningitidis_ Δ_proQ_ (Fig. 7). Therefore, regulating genome integrity may indeed be a core function of FinO-domain proteins. Yet, our
observed oxidative stress phenotypes were only partially restored in the complemented strains (Fig. 7). This suggests that either the presence of the FLAG-tag interferes with proper
functioning of the ProQ protein in the complemented strains and/or that ProQ levels must be tightly controlled for successful DNA damage and oxidative stress repair. Incomplete
complementation of ProQ function was indeed reported before for ProQ-dependent host invasion control5, _rho_ mRNA regulation, and sRNA expression2 in _Salmonella_. Therefore, the success of
complementation might be dependent on the abundance of the direct RNA targets as well as associated nucleases. On the molecular level, we identified direct ProQ target genes that could
contribute to the observed phenotypes, such as the superoxide dismutase _sodC_ (Fig. 4, Supplementary Fig. 6, Supplementary Data 1). SodC has been reported to protect _N. meningitidis_
against oxidative stress41. In addition, the direct ProQ target gene _pnp_ (Fig. 4 and Supplementary Fig. 5) is known to contribute to processing of UV-light induced double-strand breaks in
_Bacillus subtilis_ and _E. coli_42,43, and may function in _N. meningitidis_ in a similar manner. Recently, several proteins have been identified that are not damaged by oxidative stress
conditions, but rather use ROS-mediated thiol modifications to regulate their function44. Reversible oxidation of specific cysteine residues allows these redox-regulated proteins to quickly
regulate diverse processes such as protein quality control (Hsp33), gene expression (OxyR) and metabolic fluxes (GapDH)45,46,47. Interestingly, the chromosome-encoded ProQ in _E. coli_ has
been identified as a redox-sensitive protein upon both H2O2 and NaOCl stress38,40. Of note, the majority of proteins with NaOCl-sensitive cysteines differed significantly from the proteins
with H2O2-sensitive cysteines, indicating that the two physiological oxidants regulate distinct sets of in vivo target proteins38. It is tempting to speculate that the constitutively
expressed meningococcal ProQ protein is regulated by ROS-mediated thiol modifications induced by several physiological oxidants, thus allowing to quickly regulate global gene expression.
However, the thiol-modified cysteine (C88) detected in _E. coli_38 is not conserved among meningococci (Fig. 1b), though the _N. meninigitidis_ ProQ harbors other cysteine residues which may
function similarly. Perhaps the most important results obtained with this minimal FinO-domain protein is that ProQ/FinO-domain proteins are intrinsically global RNA binders that recognize
some abundant type of RNA shape. It now appears that binding selectivity evolves through the acquisition of additional N-terminal and C-terminal linkers and domains that narrow target
recognition. It is also now clear that there is no correlation between the sizes of ProQ proteins and the size of their target suites. What then might be driving changes in the domain
composition of the ProQ protein? Many γ-proteobacteria including the _Enterobacterales_ possess, on average, the largest ProQ proteins (Fig. 1a). Many _Enterobacterales_ species inhabit a
number of different ecological niches such as soil, water, and the intestines of living organisms that imply exposure to a wide range of environmental conditions with a wide range of
differing temperatures. Could this environmental complexity be a driving force in the evolution of more complex ProQ proteins, containing additional domains that modulate the FinO domain’s
function? In contrast, small ProQ proteins are found in many medically important α-proteobacteria as well as in the β-proteobacteria, including _N. meninigitidis_. These bacteria have rather
restricted ecological niches with less varying temperatures. This is well illustrated by _N. meningitidis_, which has a minimal ProQ protein and a lifestyle restricted to the human
nasopharynx. METHODS BACTERIAL GROWTH AND CONSTRUCTION OF MUTANT STRAINS A list containing all bacterial strains used in this study is provided in Supplementary Table 2. _N. meningitidis_
cells were routinely grown at 37 °C in 5% CO2 with 95% humidity on either Columbia blood agar plates (Becton Dickinson) or GC agar plates (22.2 mM glucose, 0.68 mM glutamine, 0.45 mM
co-carboxylase, 1.23 mM Fe(NO3)3; all from Sigma) containing 20 μg ml−1 erythromicin, 50 μg ml−1 kanamycin, or 20 μg ml−1 chloramphenicol (final concentration) as required. Liquid cultures
were grown in GCBL++ medium in either 50 ml tubes or 96-well microtiter plates at 37 °C with vigorous shaking. Growth in 96‐well microtiter plates was monitored using the Infinite F 200 Pro
instrument (Tecan) at 37 °C with 3 mm amplitude shaking. Optical density was monitored every 30 min. More details about bacterial growth are given in the Supplementary Methods. Details about
the generation of _Neisseria_ mutant strains are listed in Supplementary Methods. Supplementary Table 2 provides a list with all generated mutant strains which were generated by natural
transformation of plasmids or PCR-amplified constructs carrying an antibiotic cassette. A list containing all plasmids utilized for mutant construction is given in Supplementary Table 3 and
a complete list of DNA oligonucleotides utilized for mutant construction including the strategy for the combinatory set-up to generate overlap PCRs is provided in Supplementary Table 4. _N.
meningitidis_ Δ_proQ_, Δ_hfq_, and Δ_proQ_Δ_hfq_ and _proQ_::3xFLAG mutant strains were constructed by sub-cloning of plasmids in _Escherichia coli_ Top10 cells as described previously14.
Briefly, the _proQ_ gene (NMV_0698) was deleted from 8013 strain by replacing the complete coding sequence by the insertion of the chloramphenicol resistance cassette catGC48. The _hfq_ gene
(NMV_1689) was deleted from strain 8013 by replacing the coding sequence by the insertion of the kanamycin resistance cassette _aphA-1_ (GE healthcare). To construct a _proQ_::3xFLAG-tagged
strain, a plasmid (3xFLAG::_aphA-1_) containing the 3xFLAG and the kanamycin resistance cassette _aphA-1_ (GE healthcare) flanked by 500 nt upstream and downstream of the _proQ_ stop codon
was cloned into _E. coli_ Top10 as described in the ref. 14. Transformants were verified by colony PCR on gDNA and in-frame fusion of _proQ_::3xFLAG by sequencing, respectively. All _N.
meningitidis_ complementation strains were constructed by overlap PCR as described in the refs. 49,14. The strains were generated by transformation of the obtained overlap PCR fragments into
the _lctP_ and _aspC_ locus of strain _N. meninigitidis_ 8013. All PCR products carried fragments encoding the target gene::3xFLAG including its native promotor, the erythromycin resistance
cassette _ermC_50 and ~500 bp of homologous sequences of the complementation locus. Transformants were verified by colony PCR on gDNA. SENSITIVITY TO UV IRRADIATION51 Briefly, serial
dilutions of _N. meningitidis_ strains grown overnight on solid media were plated on 5% Columbia blood agar plates and exposed to 2 mJ cm−2 of UV irradiation at 254 nm (UV stratalinker 1800,
Stratagene) for 2.5 s while the negative controls (0 mJ cm−2) were left in the dark for the same time prior to incubating all plates in 5% CO2 at 37 °C for 20 h51. The number of colonies
formed by the bacteria was counted with the colony counter ProtoCOL (Meintrup DWS). The survival rates were calculated as the ratio of UV-irradiated survivors to the total number of cells.
The assay was performed five times. OXIDATIVE STRESS ASSAYS52 Serial dilutions of _N. meningitidis_ strains grown overnight on solid media were exposed to H2O2 (0.25 mM) for 15 min and
paraquat (2 mM) for 60 min at 37 °C with vigorous shaking prior to plating serial dilutions on 5% Columbia blood agar plates. After incubation in 5% CO2 at 37 °C for 20 h, the survival rates
were calculated as the ratio of H2O2 and paraquat-stressed survivors to the total number of cells52. The number of colonies formed by the bacteria was counted with the colony counter
ProtoCOL (Meintrup DWS). The assays were performed five times. UV CROSSLINKING AND IMMUNOPRECIPITATION (UV-CLIP) In two replicate experiments, _N. meningitidis proQ_::3xFLAG mutant strains
expressing 3 × FLAG-tagged ProQ protein were grown in liquid GC medium containing kanamycin until an OD600nm of 2.0 representing late logarithmic growth phase. For each strain, cells
equivalent to an OD600nm of 200 were collected and subjected to UV CLIP as previously described3. Half of the culture was directly placed in a 22 by 22 cm plastic tray and irradiated with UV
light at 800 mJ cm−2 at 254 nm while the other half of bacterial cultures was stored in 50 ml Greiner tubes on ice. Cells were pelleted in 50 ml fractions by centrifugation for 40 min at
6000 × _g_ and 4 °C and resuspended in 800 µl NP-T buffer (50 mM NaH2PO4, 300 mM NaCl, 0.05% Tween, pH 8.0). The resuspended pellets were mixed with 1 ml glass beads (0.1 mm radius), 20 μl
lysozyme (25 mg ml−1, Roth) and 10 μl DNaseI (Fermentas) and incubated at 37 °C for 10 min at 900 rpm shaking. After cooling the samples for 2 min on ice, the cells were lysed using a Retsch
MM40 ball mill (30 s−1, 10 min) in pre-cooled blocks (4 °C) and centrifuged for 15 min at 16,000 × _g_ and 4 °C. Cell lysates were transferred to new tubes and centrifuged for 15 min at
16,000 × _g_ and 4 °C. The cleared lysates were mixed with one volume of NP‐T buffer with 8 M urea followed by incubation for 5 min at 65 °C in a thermomixer with shaking at 900 rpm and
dilution in 10× in ice‐cold NP‐T buffer. Meanwhile, anti‐FLAG magnetic beads (Sigma) were washed three times in NP‐T buffer (30 μl 50% bead suspension was used for a lysate from 100 ml
bacterial culture). The washed glass-beads were mixed with the cleared lysate and incubated for 1 h at 4 °C while rotating before the beads were collected by centrifugation at 800 × _g_.
After resuspending the beads in 1 ml NP‐T buffer, they were transferred to new tubes, washed once with high‐salt buffer (50 mM NaH2PO4, 1 M NaCl, 0.05% Tween, pH 8.0) and twice with NP‐T
buffer. Ten percent of the beads from each sample were resuspended in 15 μl 1× PL (0.3 M Tris-HCl pH 6.8, 0.05% Bromophenol blue, 10% Glycerol, 7% DTT) for western blot analysis of the
unlabeled eluates. After one wash with CIP buffer (100 mM NaCl, 50 mM Tris–HCl pH 7.4, 10 mM MgCl2), the beads were resuspended in 100 μl CIP buffer with 10 units of calf intestinal alkaline
phosphatase (NEB) and incubated for 30 min at 37 °C in a thermomixer with shaking at 800 rpm. After one wash with high‐salt buffer and two washes with PNK buffer (50 mM Tris–HCl pH 7.4, 10
mM MgCl2, 0.1 mM spermidine), the beads were resuspended in 1 ml NP-T buffer and stored at 4 °C overnight. After washing the beads with 1 ml PNK buffer, the remaining beads were resuspended
in 100 μl PNK buffer with 10 U of T4 polynucleotide kinase (Fermentas) and 10 μCi γ‐32P‐ATP and incubated for 15 min at 37 °C. The beads were washed three times with NP‐T buffer prior to
resuspending the beads in 20 μl Protein Loading buffer (0.3 M Tris–HCl pH 6.8, 0.05% bromophenol blue, 10% glycerol, 7% DTT) and incubation for 5 min at 95 °C with occasional vortexing. The
magnetic beads were removed on a magnetic separator. The remaining supernatant was loaded and separated on a 15% SDS–Tris-glycine (pH 6.8/8.8) polyacrylamide gel system. RNA–protein
complexes were transferred to a nitrocellulose membrane, the protein marker was highlighted with a radioactively labeled marker pen and exposed to a phosphor screen overnight. The
autoradiogram was aligned on the membrane to cut out the labeled RNA–protein complexes from the membrane. Each membrane piece was further cut into smaller pieces, which were incubated in 400
μl PK solution [50 mM Tris–HCl pH 7.4, 75 mM NaCl, 6 mM EDTA, 1% SDS, 10 U SUPERaseIN (Life Technologies), and 1 mg ml−1 proteinase K (ThermoScientific)] for 30 min in a thermomixer at 37
°C with shaking at 1100 rpm. The incubation was continued for additional 30 min after adding 100 μl 9 M urea. The tubes with the membranes were spun down and about 450 μl of the PK
solution/urea supernatant was mixed with 450 μl phenol:chloroform:isoamyl alcohol in a phase‐lock tube and incubated for 5 min in a thermomixer at 30 °C with shaking at 1,000 rpm. After
centrifugation for 12 min at 16,000 × _g_ and 4 °C, the aqueous phase was precipitated with three volumes of ice‐cold ethanol, 1/10 volume of 3 M NaOAc pH 5.2, and 1 μl of GlycoBlue (Life
Technologies) in LoBind tubes (Eppendorf). The precipitate was centrifuged for 30 min at 16,000 × _g_ and 4 °C and the resulting pellets were washed with 80% ethanol, centrifuged again for
15 min at 16,000 × _g_ and 4 °C, dried 2 min at room temperature and resuspended in 6 μl sterile water. The samples were stored at −20 °C. RNA EXTRACTION FOR NORTHERN BLOT ANALYSIS AND
RNA-SEQ Samples were collected from bacterial cultures grown in GCBL++ liquid medium to an OD600nm of 2.0, corresponding to the late logarithmic growth phase. After fixing the samples by
addition of STOP Mix [95% (vol/vol) EtOH and 5% (vol/vol) phenol], the pelleted cells were frozen in liquid nitrogen and stored at −80 °C until RNA extraction. For RNA extraction frozen
bacterial cultures were thawed on ice and centrifuged for 10 min at 4000 × _g_ at 4 °C. Cell pellets were resuspended in a lysis solution consisting of 600 µl of 0.5 mg ml−1 lysozyme in TE
buffer (pH 8.0) and 60 µl 10% SDS. Bacterial cells were lysed by heating the samples for 1–2 min at 65 °C. The lysates were used for total RNA extraction according to the hot phenol
method53. CDNA LIBRARY PREPARATION AND SEQUENCING FOR UV CLIP-SEQ AND RNA-SEQ cDNA libraries of RNA-seq-samples were constructed by Vertis Biotechnology AG, Munich, Germany. To deplete
ribosomal transcripts, RNA-seq samples were treated with the Ribo-Zero “Bacteria” kit (Illumina) followed by RNA fragmentation and adapter ligation. UV CLIP-seq libraries were prepared using
the NEBNext Multiplex Small RNA Library Prep Set for Illumina (#E7300, New England Biolabs) according to the manufacturer’s instructions as described before3. cDNA libraries of RNA-seq
samples were pooled on an Illumina NextSeq 500 high‐output flow cell and sequenced in single-read mode (1 × 76 cycles). cDNA libraries of UV CLIP samples were pooled on an Illumina NextSeq
500 mid‐output flow cell and sequenced in paired-end mode (2 × 75 cycles). The raw, de-multiplexed reads as well as the normalized coverage files of all cDNA libraries have been deposited in
the National Center for Biotechnology Information’s Gene expression omnibus (GEO) and are accessible via the GEO accession number GSE129868. Statistics on cDNA library sequencings are
summarized in Supplementary Tables 5 and 6. PROCESSING OF UV CLIP-SEQUENCE READS AND MAPPING Bioinformatic analysis of the resulting UV CLIP-reads followed the protocol established
previously4. In brief, read quality was assessed using FastQC version 0.11.2. Paired end reads were quality trimmed independently of each other for a Phred score cutoff of 20 using
fastq_quality_trimmer from the FASTX toolkit verion 0.0.13. After quality trimming, the NEBNext R1 and R2 adapters (R1: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC, R2:
GATCGTCGGACTGTAGAACTCTGAACGTGTAGATCTCGGTGGTCGCCGTATCATT) were trimmed using cutadapt v1.7154. Putative PCR duplicates were removed using FastUniq55. The remaining reads were mapped to the
_Neisseria meningitidis_ 8013 genome (NCBI accession: NC_017501.1) using READemption version 0.3.7 and segemehl version 0.2.0 with an accuracy cutoff of 80%, and only uniquely mapping reads
were retained for further analysis. NCBI annotations were supplemented with UTR and sRNA annotations previously defined using transcriptional start site mapping and computational prediction
of Rho-independent terminators14,56. PEAK CALLING (UV CLIP) Normalization and peak calling was performed using a similar procedure to that previously described4. Briefly, an exploratory
analysis showed a clear bimodal distribution of the log ratio of read counts between the cross-linked and non-cross-linked library read counts. Read counts over positions in the mode near 0
(i.e., approximately equal read counts) were used to calculate normalization factors using the geometric mean normalization procedure introduced by DESeq57. Peak calling was then performed
using the adaptive approach of PEAKachu (https://github.com/tbischler/PEAKachu, manuscript in preparation) with paired-end (-P) and paired-replicates (-r) options set, using the manually set
normalization factors described above. Peaks with a log2-fold change (log2 f.c.) greater than 2 and adjusted _P_-value (_P_adj-value, Benjamini–Hochberg corrected) less than 0.05 were
considered significant in our analysis. ANALYSIS OF CROSSLINK-SPECIFIC MUTATIONS (UV CLIP) Detection of crosslink-induced cDNA mutations was done following our previous approach3. Mutated
sites were required to be present in both paired reads mapping to a significant peak, and the first read was extracted using samtools before applying PIPE-CLIP with a false discovery rate
cut-off of 0.1 and requiring at least ten reads mapped. Any putative crosslinking induced mutations also present in non-crosslinked samples were eliminated. PROCESSING OF SEQUENCE READS AND
MAPPING (RNA-SEQ) Illumina reads were quality and adapter trimmed with Cutadapt [version 1.16 using a cutoff Phred score of 20 in NextSeq mode and reads without any remaining bases were
discarded (command line parameters: --nextseq-trim=20 -m 1 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC)]. After trimming, we applied the pipeline READemption58 version 0.4.5 to align all reads
longer than 11 nt to the _N. meningitidis_ 8013 (NCBI accession: NC_017501.1) genome using segemehl version 0.2.059 with an accuracy cut-off of 95%. DIFFERENTIAL EXPRESSION ANALYSIS
(RNA-SEQ) We applied READemption to quantify read alignments for each library with the same annotations used in the UV CLIP-seq analysis (treating pseudogenes as CDSs and excluding miscRNAs)
on the sense strand. Reads overlapping genomic features by at least 10 nt were counted as mapped to that feature. If the read overlapped more than one annotation, the value was divided by
the number of annotationss and counted separately for each annotation (e.g., 1/3 for a read mapped to 3 annotations). Differential expression analysis comparing ∆_proQ_ to wild-type samples
was done with DESeq260 version 1.22.1. Fold-change shrinkage was applied by setting the parameter betaPrior to TRUE. All features with log2 f.c. ≤ −1 or ≥1 and adjusted _P_-value < 0.05
were considered significantly differentially expressed. FUNCTIONAL ENRICHMENT ANALYSIS (RNA-SEQ) To identify functional classes overrepresented in differentially expressed protein-coding
genes in the comparison of ∆_proQ_ and wild-type strains, we applied functional enrichment analysis based on COG classes61,62 using the function “enricher” of the R package clusterProfiler63
v3.10.1. The analysis was conducted separately for all regulated genes, only upregulated genes (log2 f.c. ≥ 1) and only downregulated genes (log2 f.c. ≤ −1). Locus tags of positive genes in
each case were identified as the union of regulated CDSs, 5′UTRs and 3′UTRs, meaning that a only single feature associated with a coding sequence was required to be regulated to be included
in the analysis. Locus tags of all features not present in COG were assigned to an artificial class X (not in COG). RIFAMPICIN RNA STABILITY ASSAY Bacterial cells grown to OD600nm 2.0 were
treated with rifampicin (final concentration 500 μg ml−1). RNA samples were taken at indicated time points (0, 2, 4, 8, 16, and 32 min) and were immediately mixed with 1/5 volume of 95%
ethanol and 5% phenol and frozen in liquid nitrogen. RNA was isolated using the hot phenol method3 and RNA stability was analyzed by Northern blotting using ImageQuant Tools from AIDA
software (Raytest, Germany) for quantification of the RNA expression intensities. NORTHERN BLOT ANALYSIS For Northern blot analysis of sRNAs, 5 µg of DNase I-treated total RNA was separated
on a 6% polyacrylamide (PAA) gel containing 8.3 M urea. PAA gels were either stained with ethidium bromide or RNA was transferred onto Hybond-XL membranes (GE Healthcare). To identify mRNAs,
10 μg of total RNA was separated on 1.2% agarose gel prior to staining the gel with ethidium bromide to ensure RNA quality and to measure loaded RNA amounts. Afterward the separated RNA was
transferred onto Hybond-XL membranes (GE Hhealthcare) by capillary transfer overnight. After cross-linking, the membranes were hybridized overnight at 42 °C with γ32P-ATP end-labeled
oligodeoxyribonucleotide (Supplementary Table 4). Signals were visualized on a Phosphorimager (Typhoon FLA 7000, GE Healthcare) and quantified with the AIDA software (Raytest).
ELECTROMOBILITY SHIFT ASSAYS The _N. meninigitidis_ 8013 _proQ_ gene was cloned into pTYB11 plasmid (NEB) for intein-based expression and purification of a tagless ProQ protein. A detailed
purification protocol is given in the Supplementary Methods. DNA templates containing a T7 promoter sequence were generated by polymerase chain reaction and served as templates for in vitro
transcription. Oligos used to generate the individual DNA templates are listed in Supplementary Table 4. T7 transcription was carried out with the MEGAscript® T7 kit (Ambion) according to
the manufacturers’ protocol. Gel-shift assays were performed as previously described8. In short, 5′-end labeled RNA was denaturated (1 min at 95 °C) and cooled (5 min on ice) before adding 1
μg yeast RNA and 10× RNA structure buffer (Ambion). Afterwards, ~0.04 pmol 5′-end labeled RNA (4 nM final concentration) were mixed with increasing amounts of purified ProQ protein (30 nM
to 1 mM final concentration) in 10 μl reactions in 1× RNA structure buffer (Ambion). After incubation for 20 min at 37 °C, samples were directly loaded after addition of 3 μl 5× native
loading dye (0.5× TBE, 50% (vol/vol) glycerol, 0.2% (wt/vol) xylenecyanol and 0.2% (wt/vol) bromophenol blue) to a native 8% PAGE in 0.5× TBE % (vol/vol). Gel electrophoresis was performed
in 0.5× TBE buffer at 300 V. Afterwards, gels were dried for 45 min and analysed using a PhosphoImager (FLA-3000 Series, Fuji) and ImageQuant Tools from AIDA software (Raytest). WESTERN BLOT
ANALYSIS AND SDS-PAGE Bacterial cells grown to different growth phases were pelleted by centrifugation at 16,100 × _g_ at room temperature for 2 min and dissolved in Laemmli protein loading
buffer (62.5 mM Tris pH 6.8, 2% SDS, 10% glycerol, 5% 2-mercaptoethanol, 0.001% bromphenolblau). After heating for 5 min at 95 °C, 0.01 OD600 equivalents of samples were separated by 12%
(vol/vol) SDS-PAGE (Tris-glycine chemistry) and either stained with Coomassie 2250 (Serva, Heidelberg) or transferred to a PVDF membrane by semidry blotting as described in the ref. 64.
SEQUENCE RETRIEVAL AND ALIGNMENTS The UniProt database65 was used to retrieve information for sequence alignments of the following ProQ sequences (accession numbers are given in
parentheses): chromosome-encoded NMB1681 of _N. meninigitidis_ (Q9JY98); F plsmid encoded FinO of _E. coli_ (P29367); chromosome-encoded RocC of _L. pneumophila_ (A0A128QHZ1);
chromosome-encoded ProQ of _E.coli_ (P45577); chromosome-encoded ProQ of _S. enterica_ (A0A0H3NC79). Alignments were created using Clustal66. For the size comparison of ProQ/FinO-domain
proteins among α-proteobacteria, β-proteobacteria, γ-proteobacteria and _Neisseriales_, 939 proteins with the Pfam protein family identifier PF04352 (version 32.0)67 were included. TARGET
SUITE COMPARISONS OF PROQ AND HFQ Differences in RNA binding preferences of ProQ and Hfq were calculated with two sample test for equality of proportions with continuity correction.
Pearson’s Chi-squared test without Yate’s continuity correction as implemented in R version 3.1.1 (R Development Core Team 2013, https://www.r-project.org/) was used to compare the
distribution of genes over the different COG functional classes61 between ProQ and Hfq bound mRNAs68. ANALYSIS OF SEQUENCE AND STRUCTURE MOTIFS The sequences of significant ProQ peaks (log2
f.c. > 2, _p_adj-value < 0.05) situated in 3′UTRs and CDSs were used for sequence motif identification with the MEME program18 with all parameters set at default values with the
exception of Motif search on the given strand only and sequence length limitation of 6–20 nucleotides. RNAfold69 was used to predict secondary structures of selected _N. meninigitidis_ RNA
sequences possessing a ProQ CLIP peak. REPORTING SUMMARY Further information on research design is available in the Nature Research Reporting Summary linked to this article. DATA
AVAILABILITY UV CLIP data and RNA-seq data supporting the findings of this study have been deposited at Gene Expression Omnibus under accession no. GSE129868. The source data underlying Fig.
1a, d, e, 2b, c, 3a, b, d, e, 4a, b, d, 5a, b, d, 6a, b, 7, and Supplementary Figs. 2, 3, 4b, 5b–d, 6b–d, 7b–d, 8, 9a–c, 10a, b, 12, 13a–f are provided as a Source Data file. All data is
available from the corresponding author upon reasonable request. Source data are provided with this paper. REFERENCES * Holmqvist, E. & Vogel, J. RNA-binding proteins in bacteria. _Nat.
Rev. Microbiol._ 16, 601–615 (2018). Article CAS PubMed Google Scholar * Smirnov, A. et al. Grad-seq guides the discovery of ProQ as a major small RNA-binding protein. _Proc. Natl. Acad.
Sci. USA_ 113, 11591–11596 (2016). Article CAS PubMed PubMed Central Google Scholar * Holmqvist, E. et al. Global RNA recognition patterns of post-transcriptional regulators Hfq and
CsrA revealed by UV crosslinking in vivo. _EMBO J._ 35, 991–1011 (2016). Article CAS PubMed PubMed Central Google Scholar * Holmqvist, E., Li, L., Bischler, T., Barquist, L. &
Vogel, J. Global maps of ProQ binding in vivo reveal target recognition via RNA structure and stability control at mRNA 3′ ends. _Mol. Cell_ 70, 971–982.e976 (2018). Article CAS PubMed
Google Scholar * Westermann, A. J. et al. The major RNA-binding protein ProQ impacts virulence gene expression in Salmonella enterica Serovar Typhimurium. _mBio_ 10, e02504–18 (2019).
Article CAS PubMed PubMed Central Google Scholar * Chaulk, S. G. et al. ProQ is an RNA chaperone that controls ProP levels in Escherichia coli. _Biochemistry_ 50, 3095–3106 (2011).
Article CAS PubMed Google Scholar * Smirnov, A., Wang, C., Drewry, L. L. & Vogel, J. Molecular mechanism of mRNA repression in trans by a ProQ-dependent small RNA. _EMBO J._ 36,
1029–1045 (2017). Article CAS PubMed PubMed Central Google Scholar * Olejniczak, M. & Storz, G. ProQ/FinO-domain proteins: another ubiquitous family of RNA matchmakers? _Mol.
Microbiol._ 104, 905–915 (2017). Article CAS PubMed PubMed Central Google Scholar * Mark Glover, J. N. et al. The FinO family of bacterial RNA chaperones. _Plasmid_ 78, 79–87 (2015).
Article CAS PubMed Google Scholar * Attaiech, L., Glover, J. N. M. & Charpentier, X. RNA chaperones Step out of Hfq’s shadow. _Trends Microbiol._ 25, 247–249 (2017). Article CAS
PubMed Google Scholar * Attaiech, L. et al. Silencing of natural transformation by an RNA chaperone and a multitarget small RNA. _Proc. Natl Acad. Sci. USA_ 113, 8813–8818 (2016). Article
CAS PubMed PubMed Central Google Scholar * Chaulk, S. et al. N. meningitidis 1681 is a member of the FinO family of RNA chaperones. _RNA Biol._ 7, 812–819 (2010). Article CAS PubMed
PubMed Central Google Scholar * Fantappie, L. et al. The RNA chaperone Hfq is involved in stress response and virulence in Neisseria meningitidis and is a pleiotropic regulator of
protein expression. _Infect. Immun._ 77, 1842–1853 (2009). Article CAS PubMed PubMed Central Google Scholar * Heidrich, N. et al. The primary transcriptome of Neisseria meningitidis and
its interaction with the RNA chaperone Hfq. _Nucleic Acids Res._ 45, 6147–6167 (2017). Article CAS PubMed PubMed Central Google Scholar * Smith, M. N., Crane, R. A., Keates, R. A.
& Wood, J. M. Overexpression, purification, and characterization of ProQ, a posttranslational regulator for osmoregulatory transporter ProP of Escherichia coli. _Biochemistry_ 43,
12979–12989 (2004). Article CAS PubMed Google Scholar * Rusniok, C. et al. NeMeSys: a biological resource for narrowing the gap between sequence and function in the human pathogen
Neisseria meningitidis. _Genome Biol._ 10, R110 (2009). Article PubMed PubMed Central CAS Google Scholar * Zhang, C. & Darnell, R. B. Mapping in vivo protein-RNA interactions at
single-nucleotide resolution from HITS-CLIP data. _Nat. Biotechnol._ 29, 607–614 (2011). Article CAS PubMed PubMed Central Google Scholar * Bailey, T. L., Johnson, J., Grant, C. E.
& Noble, W. S. The MEME suite. _Nucleic Acids Res._ 43, W39–W49 (2015). Article CAS PubMed PubMed Central Google Scholar * Ambur, O. H., Frye, S. A. & Tonjum, T. New functional
identity for the DNA uptake sequence in transformation and its presence in transcriptional terminators. _J. Bacteriol._ 189, 2077–2085 (2007). Article CAS PubMed Google Scholar *
Treangen, T. J., Ambur, O. H., Tonjum, T. & Rocha, E. P. The impact of the neisserial DNA uptake sequences on genome evolution and stability. _Genome Biol._ 9, R60 (2008). Article
PubMed PubMed Central CAS Google Scholar * Fantappie, L. et al. A novel Hfq-dependent sRNA that is under FNR control and is synthesized in oxygen limitation in Neisseria meningitidis.
_Mol. Microbiol._ 80, 507–523 (2011). Article CAS PubMed Google Scholar * Fagnocchi, L. et al. Global transcriptome analysis reveals small RNAs affecting Neisseria meningitidis
bacteremia. _PLoS ONE_ 10, e0126325 (2015). Article PubMed PubMed Central CAS Google Scholar * Wassarman, K. M. 6S RNA: a small RNA regulator of transcription. _Curr. Opin. Microbiol._
10, 164–168 (2007). Article CAS PubMed Google Scholar * Huis in ‘t Veld, R. A. et al. Deep sequencing whole transcriptome exploration of the sigmaE regulon in Neisseria meningitidis.
_PLoS ONE_ 6, e29002 (2011). Article ADS PubMed PubMed Central CAS Google Scholar * Kamarthapu, V. & Nudler, E. Rethinking transcription coupled DNA repair. _Curr. Opin.
Microbiol._ 24, 15–20 (2015). Article CAS PubMed PubMed Central Google Scholar * Rosenstein, N. E., Perkins, B. A., Stephens, D. S., Popovic, T. & Hughes, J. M. Meningococcal
disease. _N. Engl. J. Med._ 344, 1378–1388 (2001). Article CAS PubMed Google Scholar * Rouphael, N. G. & Stephens, D. S. Neisseria meningitidis: biology, microbiology, and
epidemiology. _Methods Mol. Biol._ 799, 1–20 (2012). Article CAS PubMed PubMed Central Google Scholar * Stephens, D. S., Greenwood, B. & Brandtzaeg, P. Epidemic meningitis,
meningococcaemia, and Neisseria meningitidis. _Lancet_ 369, 2196–2210 (2007). Article PubMed Google Scholar * Imlay, J. A., Chin, S. M., Linn, S. & Toxic, D. N. A. damage by hydrogen
peroxide through the Fenton reaction in vivo and in vitro. _Science_ 240, 640–642 (1988). Article ADS CAS PubMed Google Scholar * Roberts, L. Infectious disease. An ill wind, bringing
meningitis. _Science_ 320, 1710–1715 (2008). Article CAS PubMed Google Scholar * Pannekoek, Y. et al. Molecular characterization and identification of proteins regulated by Hfq in
Neisseria meningitidis. _FEMS Microbiol. Lett._ 294, 216–224 (2009). Article CAS PubMed Google Scholar * Vogel, J. & Luisi, B. F. Hfq and its constellation of RNA. _Nat. Rev.
Microbiol._ 9, 578–589 (2011). Article CAS PubMed PubMed Central Google Scholar * Updegrove, T. B., Zhang, A. & Storz, G. Hfq: the flexible RNA matchmaker. _Curr. Opin. Microbiol._
30, 133–138 (2016). Article CAS PubMed PubMed Central Google Scholar * Gonzalez, G. M. et al. Structure of the Escherichia coli ProQ RNA-binding protein. _RNA_ 23, 696–711 (2017).
Article CAS PubMed PubMed Central Google Scholar * Holmqvist, E. & Vogel, J. A small RNA serving both the Hfq and CsrA regulons. _Genes Dev._ 27, 1073–1078 (2013). Article CAS
PubMed PubMed Central Google Scholar * Jorgensen, M. G., Thomason, M. K., Havelund, J., Valentin-Hansen, P. & Storz, G. Dual function of the McaS small RNA in controlling biofilm
formation. _Genes Dev._ 27, 1132–1145 (2013). Article PubMed PubMed Central CAS Google Scholar * Chao, Y., Papenfort, K., Reinhardt, R., Sharma, C. M. & Vogel, J. An atlas of
Hfq-bound transcripts reveals 3’ UTRs as a genomic reservoir of regulatory small RNAs. _EMBO J._ 31, 4005–4019 (2012). Article CAS PubMed PubMed Central Google Scholar * Leichert, L. I.
et al. Quantifying changes in the thiol redox proteome upon oxidative stress in vivo. _Proc. Natl Acad. Sci. USA_ 105, 8197–8202 (2008). Article ADS CAS PubMed PubMed Central Google
Scholar * Skunca, N. et al. Phyletic profiling with cliques of orthologs is enhanced by signatures of paralogy relationships. _PLoS Comput. Biol._ 9, e1002852 (2013). Article CAS PubMed
PubMed Central Google Scholar * Xie, K., Bunse, C., Marcus, K. & Leichert, L. I. Quantifying changes in the bacterial thiol redox proteome during host-pathogen interaction. _Redox
Biol._ 21, 101087 (2019). Article CAS PubMed Google Scholar * Wilks, K. E. et al. Periplasmic superoxide dismutase in meningococcal pathogenicity. _Infect. Immun._ 66, 213–217 (1998).
Article CAS PubMed PubMed Central Google Scholar * Cardenas, P. P. et al. Polynucleotide phosphorylase exonuclease and polymerase activities on single-stranded DNA ends are modulated by
RecN, SsbA and RecA proteins. _Nucleic Acids Res._ 39, 9250–9261 (2011). Article CAS PubMed PubMed Central Google Scholar * Rath, D., Mangoli, S. H., Pagedar, A. R. & Jawali, N.
Involvement of pnp in survival of UV radiation in Escherichia coli K-12. _Microbiology_ 158, 1196–1205 (2012). Article CAS PubMed Google Scholar * Kiley, P. J. & Storz, G. Exploiting
thiol modifications. _PLoS Biol._ 2, e400 (2004). Article PubMed PubMed Central CAS Google Scholar * Jakob, U., Muse, W., Eser, M. & Bardwell, J. C. Chaperone activity with a redox
switch. _Cell_ 96, 341–352 (1999). Article CAS PubMed Google Scholar * Zheng, M., Aslund, F. & Storz, G. Activation of the OxyR transcription factor by reversible disulfide bond
formation. _Science_ 279, 1718–1721 (1998). Article ADS CAS PubMed Google Scholar * Leslie, N. R. et al. Redox regulation of PI 3-kinase signalling via inactivation of PTEN. _EMBO J._
22, 5501–5510 (2003). Article CAS PubMed PubMed Central Google Scholar * Kahrs, A. F. et al. An improved TnMax mini-transposon system suitable for sequencing, shuttle mutagenesis and
gene fusions. _Gene_ 167, 53–57 (1995). Article CAS PubMed Google Scholar * Dugar, G. et al. The CsrA-FliW network controls polar localization of the dual-function flagellin mRNA in
Campylobacter jejuni. _Nat. Commun._ 7, 11667 (2016). Article ADS CAS PubMed PubMed Central Google Scholar * Zhang, Y. et al. Processing-independent CRISPR RNAs limit natural
transformation in Neisseria meningitidis. _Mol. Cell_ 50, 488–503 (2013). Article CAS PubMed PubMed Central Google Scholar * Davidsen, T., Tuven, H. K., Bjoras, M., Rodland, E. A. &
Tonjum, T. Genetic interactions of DNA repair pathways in the pathogen Neisseria meningitidis. _J. Bacteriol._ 189, 5728–5737 (2007). Article CAS PubMed PubMed Central Google Scholar *
Takahashi, H., Watanabe, H., Kim, K. S., Yokoyama, S. & Yanagisawa, T. The meningococcal cysteine transport system plays a crucial role in neisseria meningitidis survival in human brain
microvascular endothelial cells. _mBio_ 9, e02332–18 (2018). Article PubMed PubMed Central Google Scholar * Blomberg, P., Wagner, E. G. & Nordstrom, K. Control of replication of
plasmid R1: the duplex between the antisense RNA, CopA, and its target, CopT, is processed specifically in vivo and in vitro by RNase III. _EMBO J._ 9, 2331–2340 (1990). Article CAS PubMed
PubMed Central Google Scholar * Martin, M. Cutadapt removes adapter sequences from high-throughput sequencing reads. _EMBnet. J._ 17, 3 (2011). Article Google Scholar * Xu, H. et al.
FastUniq: a fast de novo duplicates removal tool for paired short reads. _PLoS ONE_ 7, e52249 (2012). Article ADS CAS PubMed PubMed Central Google Scholar * Gardner, P. P., Barquist,
L., Bateman, A., Nawrocki, E. P. & Weinberg, Z. RNIE: genome-wide prediction of bacterial intrinsic terminators. _Nucleic Acids Res._ 39, 5845–5852 (2011). Article CAS PubMed PubMed
Central Google Scholar * Anders, S. & Huber, W. Differential expression analysis for sequence count data. _Genome Biol._ 11, R106 (2010). Article CAS PubMed PubMed Central Google
Scholar * Forstner, K. U., Vogel, J. & Sharma, C. M. READemption-a tool for the computational analysis of deep-sequencing-based transcriptome data. _Bioinformatics_ 30, 3421–3423
(2014). Article PubMed CAS Google Scholar * Hoffmann, S. et al. Fast mapping of short sequences with mismatches, insertions and deletions using index structures. _PLoS Comput. Biol._ 5,
e1000502 (2009). Article MathSciNet PubMed PubMed Central CAS Google Scholar * Love, M. I., Huber, W. & Anders, S. Moderated estimation of fold change and dispersion for RNA-seq
data with DESeq2. _Genome Biol._ 15, 550 (2014). Article PubMed PubMed Central CAS Google Scholar * Galperin, M. Y., Makarova, K. S., Wolf, Y. I. & Koonin, E. V. Expanded microbial
genome coverage and improved protein family annotation in the COG database. _Nucleic Acids Res._ 43, D261–D269 (2015). Article CAS PubMed Google Scholar * Tatusov, R. L. et al. The COG
database: new developments in phylogenetic classification of proteins from complete genomes. _Nucleic Acids Res._ 29, 22–28 (2001). Article CAS PubMed PubMed Central Google Scholar *
Yu, G., Wang, L. G., Han, Y. & He, Q. Y. clusterProfiler: an R package for comparing biological themes among gene clusters. _Omics_ 16, 284–287 (2012). Article CAS PubMed PubMed
Central Google Scholar * Urban, J. H. & Vogel, J. Translational control and target recognition by Escherichia coli small RNAs in vivo. _Nucleic Acids Res._ 35, 1018–1037 (2007).
Article CAS PubMed PubMed Central Google Scholar * The_UniProt_Consortium. UniProt: a worldwide hub of protein knowledge. _Nucleic Acids Res._ 47, D506–d515 (2019). Article CAS Google
Scholar * Madeira, F. et al. The EMBL-EBI search and sequence analysis tools APIs in 2019. _Nucleic Acids Res._ 47, W636–W641 (2019). Article CAS PubMed PubMed Central Google Scholar
* El-Gebali, S. et al. The Pfam protein families database in 2019. _Nucleic Acids Res._ 47, D427–d432 (2019). Article CAS PubMed Google Scholar * Holm, S. A simple sequentially rejective
multiple test procedure. _Scand. J. Stat._ 6, 65–70 (1979). MathSciNet MATH Google Scholar * Lorenz, R. et al. ViennaRNA Package 2.0. _Algorithms Mol. Biol._ 6, 26 (2011). Article
PubMed PubMed Central Google Scholar Download references ACKNOWLEDGEMENTS We thank Maren Bleckmann for purification of the ProQ protein. We thank Helene Mehling and Barbara Conrad for
assisting the laboratory work. We thank the Helmholtz Institute for RNA-based Infection Research (HIRI) who supported this work with a seed grant through funds from the Bavarian Ministry of
Economic Affairs and Media, Energy and Technology (Grant allocation nos. 0703/68674/5/2017 and 0703/89374/3/2017). In addition, this work was supported by Interdisciplinary Center for
Clinical Research Würzburg Grant IZKF Z-6 (to T.B.). AUTHOR INFORMATION Author notes * These authors contributed equally: Saskia Bauriedl, Milan Gerovac. * These authors jointly supervised
this work: Jörg Vogel, Christoph Schoen. AUTHORS AND AFFILIATIONS * Institute for Hygiene and Microbiology, University of Würzburg, 97080, Würzburg, Germany Saskia Bauriedl & Christoph
Schoen * Institute for Molecular Infection Biology (IMIB), University of Würzburg, 97080, Würzburg, Germany Milan Gerovac, Nadja Heidrich, Thorsten Bischler & Jörg Vogel * Helmholtz
Institute for RNA-based Infection Research (HIRI), Helmholtz Centre for Infection Research (HZI), 97080, Würzburg, Germany Lars Barquist & Jörg Vogel * Faculty of Medicine, University of
Würzburg, 97080, Würzburg, Germany Lars Barquist Authors * Saskia Bauriedl View author publications You can also search for this author inPubMed Google Scholar * Milan Gerovac View author
publications You can also search for this author inPubMed Google Scholar * Nadja Heidrich View author publications You can also search for this author inPubMed Google Scholar * Thorsten
Bischler View author publications You can also search for this author inPubMed Google Scholar * Lars Barquist View author publications You can also search for this author inPubMed Google
Scholar * Jörg Vogel View author publications You can also search for this author inPubMed Google Scholar * Christoph Schoen View author publications You can also search for this author
inPubMed Google Scholar CONTRIBUTIONS S.B. contributed to project design, experimental work, data analysis and interpretation and drafting of the manuscript. M.G. carried out size
distribution analysis of ProQ/ FinO-domain proteins, and produced recombinant PNPase. N.H. contributed to project design and experimental work. T.B. carried out RNA-seq analysis and
developed associated figures. L.B. performed computational analysis of UV-CLIP data, and contributed to manuscript review and editing. C.S. is the corresponding author and provided
assistance on statistical analyses, COG analyses and conception, data interpretation, drafting and writing the manuscript. J.V. is the corresponding author and oversaw the project conception
and design, data interpretation and writing the manuscript. CORRESPONDING AUTHORS Correspondence to Jörg Vogel or Christoph Schoen. ETHICS DECLARATIONS COMPETING INTERESTS The authors
declare no competing interests. ADDITIONAL INFORMATION PEER REVIEW INFORMATION _Nature Communications_ thanks the anonymous reviewer(s) for their contribution to the peer review of this
work. Peer reviewer reports are available. PUBLISHER’S NOTE Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION PEER REVIEW FILE REPORTING SUMMARY DESCRIPTION OF ADDITIONAL SUPPLEMENTARY FILES SUPPLEMENTARY DATA 1 SUPPLEMENTARY DATA 2 SUPPLEMENTARY
DATA 3 SUPPLEMENTARY DATA 4 SUPPLEMENTARY DATA 5 SOURCE DATA SOURCE DATA FILE RIGHTS AND PERMISSIONS OPEN ACCESS This article is licensed under a Creative Commons Attribution 4.0
International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the
source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative
Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by
statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit
http://creativecommons.org/licenses/by/4.0/. Reprints and permissions ABOUT THIS ARTICLE CITE THIS ARTICLE Bauriedl, S., Gerovac, M., Heidrich, N. _et al._ The minimal meningococcal ProQ
protein has an intrinsic capacity for structure-based global RNA recognition. _Nat Commun_ 11, 2823 (2020). https://doi.org/10.1038/s41467-020-16650-6 Download citation * Received: 09
September 2019 * Accepted: 03 April 2020 * Published: 04 June 2020 * DOI: https://doi.org/10.1038/s41467-020-16650-6 SHARE THIS ARTICLE Anyone you share the following link with will be able
to read this content: Get shareable link Sorry, a shareable link is not currently available for this article. Copy to clipboard Provided by the Springer Nature SharedIt content-sharing
initiative